SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma05g01000

Feature Type:gene_model
Chromosome:Gm05
Start:606481
stop:608812
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma05g01000
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G74470AT Annotation by Michelle Graham. TAIR10: Pyridine nucleotide-disulphide oxidoreductase family protein | chr1:27991248-27992845 FORWARD LENGTH=467 SoyBaseE_val: 0ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0051188GO-bp Annotation by Michelle Graham. GO Biological Process: cofactor biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016628GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0045550GO-mf Annotation by Michelle Graham. GO Molecular Function: geranylgeranyl reductase activity SoyBaseN/AISS
PTHR10617Panther FLAVOPROTEIN-UBIQUINONE OXIDOREDUCTASE JGI ISS
PTHR10617:SF9Panther ELECTRON TRANSFER FLAVOPROTEIN QUINONE OXIDOREDUCTASE JGI ISS
PF07992PFAM Pyridine nucleotide-disulphide oxidoreductase JGI ISS
UniRef100_Q9XE94UniRef Annotation by Michelle Graham. Most informative UniRef hit: Geranylgeranyl hydrogenase n=1 Tax=Glycine max RepID=Q9XE94_SOYBN SoyBaseE_val: 0ISS
UniRef100_UPI0001D16381UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001D16381 related cluster n=1 Tax=unknown RepID=UPI0001D16381 SoyBaseE_val: 0ISS

Expression Patterns of Glyma05g01000
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma05g01000
ParalogEvidenceComments
Glyma17g10890 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma05g01000 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.05g026200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma05g01000
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma05g01000
>Glyma05g01000.1   sequence type=CDS   gene model=Glyma05g01000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACTCCATAGCCTTCAAATCCTTCGTCGGCCTCCGCCAGTCCTCGCCGGAGGCCCCGCATTTCGCCGCCCAGCCAAGACCCGCCACTCCCCACCGCAAATTCCGCGTCTTGGCTGGAAAATTCAGCCCCAAGCTCAATGGCCGGAACCTCCGCGTGGCGGTGGTGGGAGGCGGTCCGGCTGGCGGGGCCGCCGCGGAGACGCTGGCGAAGGGCGGCGTGGAGACGTTCCTGATCGAGCGAAAGATGGACAACTGCAAGCCGTGCGGTGGCGCCATCCCGCTGTGCATGGTGGGGGAGTTCGACCTGCCGCTGGACATCATCGACCGGCGCGTGACGAAGATGAAGATGATATCGCCGTCGAACGTGGCGGTGGACATCGGGAGGACGCTGAAGCCGCACGAGTACATCGGCATGGTGCGGCGCGAGGTGCTGGACGCTTACCTCAGGGACCGCGCCAAGGAGTACGGTGCGAACGTCATCAATGGCTTGTTCTTGAAAATGGATATTCCTAAGGATAAGAACTCCCCCTACGTTCTGCATTACTCTAGCTACGATGGCAAAACCAATGGGGCTGGTGAGAAGCGTACCTTGGAAGTTGACGCTGTCATTGGCGCTGACGGGGCTAATTCTAGAGTCGCCAAGTCTATTGATGCCGGTGATTATGAGTATGCCATCGCTTTTCAGGAGAGGGTAAAAATCCCGGATGATAAGATGGTGTATTACGAGAACCTTGCGGAGATGTACGTGGGCGATGATGTTTCTCCAGATTTCTACGGGTGGGTGTTTCCAAAATGTGACCATGTGGCTGTAGGCACTGGAACTGTGACACACAAGGGGGACATCAAGAAGTTCCAACTAGCAACAAGGAAAAGAGCAGAGGACAAGATTTTGGGAGGCAAGATCATCCGAGTGGAGGCTCACCCTATCCCGGAACATCCTCGGCCACGAAGGTTGTTGGGGAGAGTGGCGCTGGTTGGCGACGCTGCTGGCTACGTAACCAAATGCTCCGGAGAGGGGATCTATTTTGCAGCCAAGAGTGGGAGGATGTGTGCAGAGGCAATTGTTGAAGGTTCTGAGAATGGGAAAAGGATGGTGGAAGAAGGGGACTTGAGGAAGTACTTGGAGAAGTGGGACAAGACTTATTGGCCAACTTACAAGGTCTTGGATATTCTTCAGAAGGTGTTTTATAGGTCCAACCCTGCAAGGGAAGCGTTTGTGGAGATGTGTGCTGATGAGTATGTGCAGAAGATGACCTTTGATAGCTACTTGTACAAGACAGTGGTGCCTGGCAATCCATTGGAGGATCTGAAATTGGCCATTAACACCATTGGGAGCTTAGTGAGGGCCAATGCCATAAGGAGGGAGATGAACAAACTTAACGTATGA
Predicted protein sequences of Glyma05g01000
>Glyma05g01000.1   sequence type=predicted peptide   gene model=Glyma05g01000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNSIAFKSFVGLRQSSPEAPHFAAQPRPATPHRKFRVLAGKFSPKLNGRNLRVAVVGGGPAGGAAAETLAKGGVETFLIERKMDNCKPCGGAIPLCMVGEFDLPLDIIDRRVTKMKMISPSNVAVDIGRTLKPHEYIGMVRREVLDAYLRDRAKEYGANVINGLFLKMDIPKDKNSPYVLHYSSYDGKTNGAGEKRTLEVDAVIGADGANSRVAKSIDAGDYEYAIAFQERVKIPDDKMVYYENLAEMYVGDDVSPDFYGWVFPKCDHVAVGTGTVTHKGDIKKFQLATRKRAEDKILGGKIIRVEAHPIPEHPRPRRLLGRVALVGDAAGYVTKCSGEGIYFAAKSGRMCAEAIVEGSENGKRMVEEGDLRKYLEKWDKTYWPTYKVLDILQKVFYRSNPAREAFVEMCADEYVQKMTFDSYLYKTVVPGNPLEDLKLAINTIGSLVRANAIRREMNKLNV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo