SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G61210 | AT | Annotation by Michelle Graham. TAIR10: soluble N-ethylmaleimide-sensitive factor adaptor protein 33 | chr5:24624027-24625366 FORWARD LENGTH=300 | SoyBase | E_val: 4.00E-129 | ISS |
| GO:0000165 | GO-bp | Annotation by Michelle Graham. GO Biological Process: MAPK cascade | SoyBase | N/A | ISS |
| GO:0000910 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytokinesis | SoyBase | N/A | ISS |
| GO:0000911 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation | SoyBase | N/A | ISS |
| GO:0002679 | GO-bp | Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response | SoyBase | N/A | ISS |
| GO:0006499 | GO-bp | Annotation by Michelle Graham. GO Biological Process: N-terminal protein myristoylation | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0006820 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anion transport | SoyBase | N/A | ISS |
| GO:0006862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide transport | SoyBase | N/A | ISS |
| GO:0006888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0009595 | GO-bp | Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus | SoyBase | N/A | ISS |
| GO:0009611 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to wounding | SoyBase | N/A | ISS |
| GO:0009612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus | SoyBase | N/A | ISS |
| GO:0009620 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to fungus | SoyBase | N/A | ISS |
| GO:0009625 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to insect | SoyBase | N/A | ISS |
| GO:0009627 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance | SoyBase | N/A | ISS |
| GO:0009695 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009697 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process | SoyBase | N/A | ISS |
| GO:0009737 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus | SoyBase | N/A | ISS |
| GO:0009753 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus | SoyBase | N/A | ISS |
| GO:0009862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009863 | GO-bp | Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0009867 | GO-bp | Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010200 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to chitin | SoyBase | N/A | ISS |
| GO:0010310 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0015696 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ammonium transport | SoyBase | N/A | ISS |
| GO:0015802 | GO-bp | Annotation by Michelle Graham. GO Biological Process: basic amino acid transport | SoyBase | N/A | ISS |
| GO:0016192 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0030968 | GO-bp | Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response | SoyBase | N/A | ISS |
| GO:0031348 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response | SoyBase | N/A | ISS |
| GO:0042742 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to bacterium | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid import | SoyBase | N/A | ISS |
| GO:0043269 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of ion transport | SoyBase | N/A | ISS |
| GO:0043900 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process | SoyBase | N/A | ISS |
| GO:0045087 | GO-bp | Annotation by Michelle Graham. GO Biological Process: innate immune response | SoyBase | N/A | ISS |
| GO:0050832 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response to fungus | SoyBase | N/A | ISS |
| GO:0051707 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to other organism | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009504 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell plate | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0005484 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: SNAP receptor activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| KOG3065 | KOG | SNAP-25 (synaptosome-associated protein) component of SNARE complex | JGI | ISS | |
| PTHR19305 | Panther | SYNAPTOSOMAL ASSOCIATED PROTEIN | JGI | ISS | |
| PF05739 | PFAM | SNARE domain | JGI | ISS | |
| UniRef100_F5C0G9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: SNAP33 n=1 Tax=Solanum chacoense RepID=F5C0G9_SOLCH | SoyBase | E_val: 2.00E-142 | ISS |
| UniRef100_I1JZK8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JZK8_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma05g00640 not represented in the dataset |
Glyma05g00640 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma17g08450 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.05g023100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma05g00640.1 sequence type=CDS gene model=Glyma05g00640 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCTGGTTCAAAGAAATCTCCTTTGAAGGTTGCTAAGCCTAGCTCTGCTGAATCTTGGACGAATCCATTTGATTCTGATGATGAGGGAAAGGATAGCAAAAAATATAGTTCCTCTAGAAAAACTTCTTCGGAGCGCGCACTTGCTACACTGGAAGTTAACACCAACCCCTTTGATGATGATATTGATGCCAATAAGAAATCTTCATCAACTTCGTATGCCTTTCAATCTGCCAACCGGAACAGGTATAAGAATGATTTTCGTGACTCTGGTGGATTAGAGAATCAATCGGTTCAAGAACTGGAGAGTTATGCTGTTTACAAGGCTGAAGAGACTACAAATTCAGTCAACAATTGTTTGAAGATAGCAGAGAACATAAGAGAGGATGCTACCAAGACACTAGTCACCCTTGAACAACAGGGTGAACAAATTACCAGGAGTCACCATGTTGCTGCTGACATTGATCACGATTTAAGTCGGGGAGAAAAGCTCTTGGGAAGCCTTGGTGGCCTCTTCTCCAAAACTTGGAAACCAAAGAAGACACGAGCAATAACCGGCCCTGTTATTGTTGGAGATGATCCGGTCAGGAGAAAGGACAATCACTTGGAGCAGAGAGACAAGTTGGGACTGACCTCTGCACCCAAAGGGCAGTCCAAGCTACGGACCCCCCCTCCAGAACCAACAAATGCACTTGAAAAAGTTGAGGTTGAAAAAAAGAAGCAAGATGATGCACTATCAGATTTAAGTGATCTGTTGGGAGAGCTTAAAGACATGGCTGTTGACATGGGATCCGAGATTGAGAGGCATAACAAAGCCCTGAATCATCTATACGATGATGTGGATGAGTTGAATTTCCGAGTGAAAGGTGCTAATCAACGTGGCCGTCGTTTGCTCGGAAAATAA
>Glyma05g00640.1 sequence type=predicted peptide gene model=Glyma05g00640 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSGSKKSPLKVAKPSSAESWTNPFDSDDEGKDSKKYSSSRKTSSERALATLEVNTNPFDDDIDANKKSSSTSYAFQSANRNRYKNDFRDSGGLENQSVQELESYAVYKAEETTNSVNNCLKIAENIREDATKTLVTLEQQGEQITRSHHVAADIDHDLSRGEKLLGSLGGLFSKTWKPKKTRAITGPVIVGDDPVRRKDNHLEQRDKLGLTSAPKGQSKLRTPPPEPTNALEKVEVEKKKQDDALSDLSDLLGELKDMAVDMGSEIERHNKALNHLYDDVDELNFRVKGANQRGRRLLGK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
