Report for Sequence Feature Glyma05g00300
Feature Type: gene_model
Chromosome: Gm05
Start: 104647
stop: 106852
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma05g00300
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G60970 AT
Annotation by Michelle Graham. TAIR10: TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 5 | chr5:24535570-24536652 REVERSE LENGTH=360
SoyBase E_val: 5.00E-47 ISS
GO:0000165 GO-bp
Annotation by Michelle Graham. GO Biological Process: MAPK cascade
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0006612 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane
SoyBase N/A ISS
GO:0009617 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to bacterium
SoyBase N/A ISS
GO:0009793 GO-bp
Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy
SoyBase N/A ISS
GO:0009862 GO-bp
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009867 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009965 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis
SoyBase N/A ISS
GO:0010027 GO-bp
Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization
SoyBase N/A ISS
GO:0010228 GO-bp
Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem
SoyBase N/A ISS
GO:0010310 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process
SoyBase N/A ISS
GO:0010363 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response
SoyBase N/A ISS
GO:0016226 GO-bp
Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly
SoyBase N/A ISS
GO:0016556 GO-bp
Annotation by Michelle Graham. GO Biological Process: mRNA modification
SoyBase N/A ISS
GO:0030154 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell differentiation
SoyBase N/A ISS
GO:0031348 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response
SoyBase N/A ISS
GO:0035304 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0045962 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of development, heterochronic
SoyBase N/A ISS
GO:0048366 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf development
SoyBase N/A ISS
GO:0048481 GO-bp
Annotation by Michelle Graham. GO Biological Process: ovule development
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
PF03634 PFAM
TCP family transcription factor
JGI ISS
UniRef100_G7IZC4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: TCP family transcription factor containing protein n=1 Tax=Medicago truncatula RepID=G7IZC4_MEDTR
SoyBase E_val: 2.00E-85 ISS
UniRef100_I1JZH3 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JZH3_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma05g00300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma05g00300
Paralog Evidence Comments
Glyma17g08761 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma05g00300 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.05g019900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma05g00300
Coding sequences of Glyma05g00300
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma05g00300.2 sequence type=CDS gene model=Glyma05g00300 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGATGATTGAAAGTTCAGGTAAAGTTCATGAAGCCAAAAATCAACAAGAGGGTGATGATGATAACAACATTAAAATTGAGAAGCTCTTGAAGGCACGACCCTCCACCTCCTCATCATCAAGATCATGGTCAGCATTCAGAAATCCAAGAATTGTGAGAGTCTCACGTTCCTTGGGAAGCAAAGATAGGCACAGCAAGGTTTGCACCATTAGGGGACTGAGGGACAGAAGGATTAGACTTTCTGTTCCCACAGCAATTCAGTTATACAATCTTCAAGACAAGCTTGGATTCAACCAACCTAGCAAGGTGGTAGATTGGTTGCTTGAAGCCACCAAATCTGATATTGACAAACTCCCACCACTTCAATTTCCTCACTGTTTTGCTCATCAGTTTCACCAGCAAACCCTACTGCCAGGTACCTCTCAGTTTTCTCTTGGAGGCTTCTATGATGCTGCTAATAACAACTCCACTTTTATTAAGGATGGGGGAAATCAAAACCGCCTCACGGCAACAAAGTCAACAAGGTATTGGGATATAGATTCACTAAATAATGGTAAGGAGTTAGCTGAAAGTGTGTCAATCTCCCAAAAAGGACAGTTCTGGATCAAAACAAATGAACAAGAAAACCATCAAGGTGGAGGAATTGGTGGTAGTAGTACTACTACTCATAATAGAGAGGATAATTCTTCAGTTCATTATAAGCTCTTCCCAATTGGGACAACTACTAATAACTCTTATTTACCTGGTTTGTTAAACAATGGCATGACACATAACTCCTACCACCATTCTGAGCCTTCAAGGCTATCTTTGTCCCACTTTGGAAGCCATGGATTGTTTCCTTCACATGATTCCCATCAAAGCAGTGGCATTGGTGTGCCATTTTCGTCTTCTAATTTCTCTGGAGCATCATCTGGTCCCCAATTGCTTTTTTGTCCAACTTCTGCTACACCATCTGCTTTTTACTCGGTGGAAAGTGATCCAAGACAATCCAACAACAATGTTCAGATCTTTAGCTCAAGTTCCCAAGTCATGAAGCGTCTTCCTCTCATCCAATCTCTTCATTCAACCAATTCACCTATTAGTCGGCGCCTTCCGACATCATTTAGCTCCAAGCTTCTTGATTCAGATAACAATGATCGTAGCCAACCAAATAAGGGTACTAGTTCTCGTTCTTGA
Predicted protein sequences of Glyma05g00300
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma05g00300.2 sequence type=predicted peptide gene model=Glyma05g00300 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MMIESSGKVHEAKNQQEGDDDNNIKIEKLLKARPSTSSSSRSWSAFRNPRIVRVSRSLGSKDRHSKVCTIRGLRDRRIRLSVPTAIQLYNLQDKLGFNQPSKVVDWLLEATKSDIDKLPPLQFPHCFAHQFHQQTLLPGTSQFSLGGFYDAANNNSTFIKDGGNQNRLTATKSTRYWDIDSLNNGKELAESVSISQKGQFWIKTNEQENHQGGGIGGSSTTTHNREDNSSVHYKLFPIGTTTNNSYLPGLLNNGMTHNSYHHSEPSRLSLSHFGSHGLFPSHDSHQSSGIGVPFSSSNFSGASSGPQLLFCPTSATPSAFYSVESDPRQSNNNVQIFSSSSQVMKRLPLIQSLHSTNSPISRRLPTSFSSKLLDSDNNDRSQPNKGTSSRS*