Report for Sequence Feature Glyma04g43171
Feature Type: gene_model
Chromosome: Gm04
Start: 48774617
stop: 48778849
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g43171
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G08210 AT
Annotation by Michelle Graham. TAIR10: Pentatricopeptide repeat (PPR-like) superfamily protein | chr4:5183813-5185873 REVERSE LENGTH=686
SoyBase E_val: 3.00E-65 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005739 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PTHR24015 Panther
FAMILY NOT NAMED
JGI ISS
PF01535 PFAM
PPR repeat
JGI ISS
UniRef100_G7J3K6 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Pentatricopeptide repeat-containing protein n=1 Tax=Medicago truncatula RepID=G7J3K6_MEDTR
SoyBase E_val: 1.00E-97 ISS
UniRef100_I1KA62 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KA62_SOYBN
SoyBase E_val: 2.00E-126 ISS
Expression Patterns of Glyma04g43171
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma04g43171
Paralog Evidence Comments
Glyma06g11520 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma04g43171 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.04g252500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma04g43171
Coding sequences of Glyma04g43171
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g43171.1 sequence type=CDS gene model=Glyma04g43171 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGTCTCTGCAATCACCAATTCTGGGAGACCCCACGAGGCTCTTACCCTCTACAACCACATGCTGGAATCCAAAACTGTGCAACCTAATCAGTTTTTGTACTCTGCGGTTCTCAAGGCATGTGGTCTCATGGGTGATGTTGAATTGGGCAAGTTGGCTCACCAACATGTATCTCAAGCTAGGTTAGAGTTTGACACAGTTCTGATGAATGCCCTTTTGGACATGTACGTCAAATGTGGGAGCTTGAGGGATGCCAAACGAGTTTTCTGTGTAAAAATTCCACTTCATGGAACACCCTCATTCTTGGACCATGCTAAACAGGGTCTGATGAGGGATGCGTTGAATCTGTTCGATCAAATGCCAGAACCAGACCTTGTTTCTTGGAATAGCATCATTGCTGGTCTTGCAGATAATGCTAGCCCCCATGCATTGCAATTTTTTTCTATGATGCATGGGAAGGGCCTTAAACATGATGCATTCACATTCCCATGTGCCCTCAAAACATGCAGTCTTCTTGGAGAGTTAACCATGGGGAGACAGATTCATTGTTGTATTATAAAGTCAGGGTTTGAGTGTAGCTGCTATTGTATATCAGCATTGATTGACATGTATTCCAATTGTAAACTATTAGATTAA
Predicted protein sequences of Glyma04g43171
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g43171.1 sequence type=predicted peptide gene model=Glyma04g43171 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MVSAITNSGRPHEALTLYNHMLESKTVQPNQFLYSAVLKACGLMGDVELGKLAHQHVSQARLEFDTVLMNALLDMYVKCGSLRDAKRVFCVKIPLHGTPSFLDHAKQGLMRDALNLFDQMPEPDLVSWNSIIAGLADNASPHALQFFSMMHGKGLKHDAFTFPCALKTCSLLGELTMGRQIHCCIIKSGFECSCYCISALIDMYSNCKLLD*