SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g41820

Feature Type:gene_model
Chromosome:Gm04
Start:47655507
stop:47657062
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g41820
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G18690AT Annotation by Michelle Graham. TAIR10: MAP kinase substrate 1 | chr3:6429755-6430423 REVERSE LENGTH=222 SoyBaseE_val: 2.00E-22ISS
GO:0009870GO-bp Annotation by Michelle Graham. GO Biological Process: defense response signaling pathway, resistance gene-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PF05678PFAM VQ motif JGI ISS
UniRef100_G7J659UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein MKS1 n=1 Tax=Medicago truncatula RepID=G7J659_MEDTR SoyBaseE_val: 3.00E-74ISS
UniRef100_I1JYW2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JYW2_SOYBN SoyBaseE_val: 2.00E-169ISS

Expression Patterns of Glyma04g41820
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g41820
ParalogEvidenceComments
Glyma06g12960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g41820 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g239400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g41820
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g41820
>Glyma04g41820.1   sequence type=CDS   gene model=Glyma04g41820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTGTCCAGTCCTCTATATTATTATCGCCACCACCCTTCCCCTCTAACCACAACATGGATCAATTCTCACACATTATTCCCACAGAAAGATCACCCAGAAGAGAACTCCAACTCCAAGGTCCACGCCCTACACCTCTCAGAATAAACAAAGACTCTCATAAAATCAAGAAACCACCCTTGGCACCACAACAACCCTCACACCCTCATCAACCCCCACCGCGCCAACCCATAATAATCTACACCGTTTCCCCCAAGGTGATTCACACCACACCAAGTGACTTCATGAACCTCGTTCAACGCCTCACTGGGTCCAGTTCTTCTTCCTCTGTAGTGGTGCCCAACAACAACAACACTCATGTCGACCCTTTCAACAACGGCGCCGGAATGTTGTCGCCGGCGGCGCGTTACGCCACCATAGAGAAAGCCATGTCCCCTATGGGGAAAAAACATGTTCTTCCAAGTGGGGATAATATTATAAGCGATGTGCAAGGGATAGAGATTAATATAGGTGATGGTGTACTTGAGAGATCACAACAAAACATGTTTCAAGGTATTTTGTCTCCTGGTCCAGCTTCACTATCTCCCATTCCTTCAAATTTTTTCTCTCCACCTTCTTCGGATCCAAGTATGGTTAGCTTCCTTCATGATTTGAGTCCTATGTTTCAAAGTGGAAGAAATTTTATGGAGGGTAGTTCTTTCGTCTTGCCTAGCCCTTCTTCAAACTTCAGCTTTGTTTCACCGCATACTCCTTCTATGGACTTATTCAACTATTTCTTAGATTAG
Predicted protein sequences of Glyma04g41820
>Glyma04g41820.1   sequence type=predicted peptide   gene model=Glyma04g41820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLVQSSILLSPPPFPSNHNMDQFSHIIPTERSPRRELQLQGPRPTPLRINKDSHKIKKPPLAPQQPSHPHQPPPRQPIIIYTVSPKVIHTTPSDFMNLVQRLTGSSSSSSVVVPNNNNTHVDPFNNGAGMLSPAARYATIEKAMSPMGKKHVLPSGDNIISDVQGIEINIGDGVLERSQQNMFQGILSPGPASLSPIPSNFFSPPSSDPSMVSFLHDLSPMFQSGRNFMEGSSFVLPSPSSNFSFVSPHTPSMDLFNYFLD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo