Report for Sequence Feature Glyma04g41740
Feature Type: gene_model
Chromosome: Gm04
Start: 47599943
stop: 47601671
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g41740
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G27950 AT
Annotation by Michelle Graham. TAIR10: cytokinin response factor 4 | chr4:13909732-13910739 REVERSE LENGTH=335
SoyBase E_val: 4.00E-52 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0042991 GO-bp
Annotation by Michelle Graham. GO Biological Process: transcription factor import into nucleus
SoyBase N/A ISS
GO:0048366 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf development
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
PF00847 PFAM
AP2 domain
JGI ISS
UniRef100_G7J693 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Ethylene responsive transcription factor 1a n=1 Tax=Medicago truncatula RepID=G7J693_MEDTR
SoyBase E_val: 7.00E-119 ISS
UniRef100_I1JYV5 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JYV5_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma04g41740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma04g41740
Paralog Evidence Comments
Glyma06g13040 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma04g41740 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.04g238700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma04g41740
Coding sequences of Glyma04g41740
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g41740.1 sequence type=CDS gene model=Glyma04g41740 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAAGACAGTATCCTATGCAAACACACAGTGCATCGCAGCGTCACCAAGAAACTCATCTCCCCCAAAAAATCATCCCAAACCAATTCTTCAACACAAACAGAGCGCAGAATAGTGCGGATTTCATACACTGATCCAGACGCCACCGACTCCTCCAGCGACGAGGAAGGTTTCCCCTTGGTTCGCAAAAGAATGAAGCGCTATGTTAACCAGATTGAAATAGAAACCGCCGCGGAAAAAGTTGTTCGGAAGAGGCCCGCCGGTGAGCCTTGCAGGCGACCGGCGAAGCTTCACTCCGGGAAGAAGTTCCGCGGCGTCCGGCAGCGGCCGTGGGGGAAATGGGCGGCGGAGATTCGAGATCCGGCGAGAAGAGTGCGTCTCTGGCTGGGAACCTACGACACTGCCGAAGAAGCTGCCATGGTCTACGACAATGCCGCTATTCGGCTTCGAGGCCCTGACGCGTTGACAAACTTCCTAACGCCACCGCAAAGAGAGTCTCCGTCTCAGGCGACAACGGTGGCGGTGACCGAAGAAGCCTCCGGCTCCGGCTACGACTCCGGCGACGACCATTGCCAGCACAACCTCTCATCTCCCACTTCGGTGCTCCACTTCCGAAGCAACTCGGAGTCTGATCAGAAATCAGAACAAGTGTTGAGAGAGTGTGAGGGTGAGGGTGAGTTTTTGGCGCTGGATAACATGCCTCTGCCTGCTTGGGATGAAGTGTTCAATTTCGAAACGCCAGAGTACCCTCCCCTTCTCTTTCAAGAAGGGAATTTTCTTCATGATTATCAGTCCCAGATGTTGGGTGAAACGGTACCGTTTTCCTCGGACCAAGGGTTCAGTGACAGTAGTATCGTGCTCGCAGACTCGCTCATAGATTTCGACAAAGCTTGCCCTCCACCATCTACCTTGTGCCAGGTGGACGATTTCTTCCAAGACATTTTGTTAGCTTCTGATCCTCTCGTTCTGCTCTGA
Predicted protein sequences of Glyma04g41740
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g41740.1 sequence type=predicted peptide gene model=Glyma04g41740 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MEDSILCKHTVHRSVTKKLISPKKSSQTNSSTQTERRIVRISYTDPDATDSSSDEEGFPLVRKRMKRYVNQIEIETAAEKVVRKRPAGEPCRRPAKLHSGKKFRGVRQRPWGKWAAEIRDPARRVRLWLGTYDTAEEAAMVYDNAAIRLRGPDALTNFLTPPQRESPSQATTVAVTEEASGSGYDSGDDHCQHNLSSPTSVLHFRSNSESDQKSEQVLRECEGEGEFLALDNMPLPAWDEVFNFETPEYPPLLFQEGNFLHDYQSQMLGETVPFSSDQGFSDSSIVLADSLIDFDKACPPPSTLCQVDDFFQDILLASDPLVLL*