SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g41220): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g41220): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g41220

Feature Type:gene_model
Chromosome:Gm04
Start:47104911
stop:47110328
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G27780AT Annotation by Michelle Graham. TAIR10: acyl-CoA binding protein 2 | chr4:13847774-13849629 FORWARD LENGTH=354 SoyBaseE_val: 1.00E-153ISS
GO:0006869GO-bp Annotation by Michelle Graham. GO Biological Process: lipid transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0006891GO-bp Annotation by Michelle Graham. GO Biological Process: intra-Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0010260GO-bp Annotation by Michelle Graham. GO Biological Process: organ senescence SoyBaseN/AISS
GO:0010288GO-bp Annotation by Michelle Graham. GO Biological Process: response to lead ion SoyBaseN/AISS
GO:0010351GO-bp Annotation by Michelle Graham. GO Biological Process: lithium ion transport SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009514GO-cc Annotation by Michelle Graham. GO Cellular Compartment: glyoxysome SoyBaseN/AISS
GO:0000062GO-mf Annotation by Michelle Graham. GO Molecular Function: fatty-acyl-CoA binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0032791GO-mf Annotation by Michelle Graham. GO Molecular Function: lead ion binding SoyBaseN/AISS
KOG0817 KOG Acyl-CoA-binding protein JGI ISS
PTHR24119Panther FAMILY NOT NAMED JGI ISS
PTHR24119:SF174Panther JGI ISS
PF00023PFAM Ankyrin repeat JGI ISS
PF00887PFAM Acyl CoA binding protein JGI ISS
UniRef100_B9SJT4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Acyl-coenzyme A binding domain containing, putative n=1 Tax=Ricinus communis RepID=B9SJT4_RICCO SoyBaseE_val: 6.00E-167ISS
UniRef100_I1JYP3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JYP3_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g41220 not represented in the dataset

Glyma04g41220 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma06g13630 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g233600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g41220.1   sequence type=CDS   gene model=Glyma04g41220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGAGTGGCAGTCCCTCCTCCAATCGATTTTCGTCGGCCTCATTTTCTCCTACCTTCTCGCCAAGCTCATTTCCATCGTCGTTTCCTTCAAAGACGACAATCTCACCGTCACGCGCGCCGCCGCCGCCGAAACCACCACAACCACGCGCGACGACGCCGTTTCCTCCGATGCGCGCCCTTTCGAGGAGGAGTCGATGGTGGCCGAGCACGGCAGCGTGAGGAACGATAGTGACGGCGACTACGACGACGACGACTGGGAAGGCGTGGAGAGCACCGAATTGGACGAGGCGTTCAGCGCCGCGACGGCGTTCGTGGACGCCGCTGCCGCCGATCGGCTCTCGCAGAAGGTGTCGAGCGACGTGCAGCTCCAGCTTTACGGGCTGTACAAGATTGCCACCGAAGGTCCTTGCAGCACGCCCCAGCCTTCGCCCCTCAAAATGACCGCACGTGCCAAATGGCAAGCGTGGCAGAAATTGGGTGCTATGCCTCCTGAAGATGCAATGCAGAAGTACATTGATATTGTGACTGAGACATATCCTACTTGGCTTGATGGTTCGTCTTTGAGGAATAAAAGTGGGGACAGTGGTGGCCATGGTTCAGAGGCTAAGGGACCTATGGGCCCAGTATTCAGTACTTTTGTTTATGAAGAGGAATATGGCAGTGACTCACAAATGGAAGCCATTCATGGATTTGCCAGGGAAGGAGATATGGCTAATCTGCTCAAGTGTATTGAAAATGGTGTTTCCATGAATTTAAAGGACAGTGAGGGCCGGACACCATTACACTGGGCTGTGGATCGTGGCCACCTTAATGTCACAGAGTTGCTTGTTGGCAAGAATGCTGATGTGAATGCCAAGGATAATGATGGACAAACTCCCTTGCATTATGCTGTTACATGTGAGAGAGAAGCCATAGCCGAGTATTTATTGAAGCATAATGCAGACATATATTCAAAAGATAATGATGGGAGTTCACCACGTGACATCTGTGAGTCAAACTGGCCCTGTATGCAGCATGTGGGGGGAGAAGTAAATTGA

>Glyma04g41220.1   sequence type=predicted peptide   gene model=Glyma04g41220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEWQSLLQSIFVGLIFSYLLAKLISIVVSFKDDNLTVTRAAAAETTTTTRDDAVSSDARPFEEESMVAEHGSVRNDSDGDYDDDDWEGVESTELDEAFSAATAFVDAAAADRLSQKVSSDVQLQLYGLYKIATEGPCSTPQPSPLKMTARAKWQAWQKLGAMPPEDAMQKYIDIVTETYPTWLDGSSLRNKSGDSGGHGSEAKGPMGPVFSTFVYEEEYGSDSQMEAIHGFAREGDMANLLKCIENGVSMNLKDSEGRTPLHWAVDRGHLNVTELLVGKNADVNAKDNDGQTPLHYAVTCEREAIAEYLLKHNADIYSKDNDGSSPRDICESNWPCMQHVGGEVN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo