SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g39330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g39330): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g39330

Feature Type:gene_model
Chromosome:Gm04
Start:45556166
stop:45557496
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g39330
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G49170AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF167) | chr1:18183561-18184434 REVERSE LENGTH=126 SoyBaseE_val: 1.00E-58ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG3276 KOG Uncharacterized conserved protein, contains YggU domain JGI ISS
PTHR13420Panther UNCHARACTERIZED JGI ISS
PF02594PFAM Uncharacterised ACR, YggU family COG1872 JGI ISS
UniRef100_C6T3W0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T3W0_SOYBN SoyBaseE_val: 1.00E-83ISS
UniRef100_Q259N2UniRef Annotation by Michelle Graham. Most informative UniRef hit: H0723C07.11 protein n=2 Tax=Oryza sativa RepID=Q259N2_ORYSA SoyBaseE_val: 1.00E-43ISS

Expression Patterns of Glyma04g39330
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g39330 not represented in the dataset
Glyma04g39330 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g39330
ParalogEvidenceComments
Glyma06g15600 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g39330 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g215300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g39330
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g39330
>Glyma04g39330.1   sequence type=CDS   gene model=Glyma04g39330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGCCGGCGAAGAGGGGAAAAGCAAAGGCGGAGCCTAAGGTAACAACGCCGTCGGAAAAACCTAATGATTTTCCGTCTTGTATTCGGAGCGTGCCTCCTTCCTCCGTCGCTATAACCATCCACGCCAAACCTGGTTCCAAATCCGCATCCGTAACTGATATAAGCGATGAAGCGGTGGGAGTGCAAATTGACGCACCTGCGAGGGATGGCGAAGCAAATGCGGCTCTTCTCGATTACATCAGTTCTGTTTTAGGTGTGAAACGAAGACAAGTTTCTTTAGGCACTGGTTCTAAGTCACGAGATAAGACAGTGATCGTGGAAGATGTAACCCAGCAATATGTTTTTGACGCTCTGGATAAAGTCTCGAAGCAGCAGTGA
Predicted protein sequences of Glyma04g39330
>Glyma04g39330.1   sequence type=predicted peptide   gene model=Glyma04g39330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPPAKRGKAKAEPKVTTPSEKPNDFPSCIRSVPPSSVAITIHAKPGSKSASVTDISDEAVGVQIDAPARDGEANAALLDYISSVLGVKRRQVSLGTGSKSRDKTVIVEDVTQQYVFDALDKVSKQQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo