Glyma04g39160 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g39160

Feature Type:	gene_model
Chromosome:	Gm04
Start:	45402243
stop:	45405522
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g39160

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G48910	AT	Annotation by Michelle Graham. TAIR10: Flavin-containing monooxygenase family protein \| chr1:18091681-18093774 FORWARD LENGTH=383	SoyBase	E_val: 6.00E-157	ISS
GO:0022603	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of anatomical structure morphogenesis	SoyBase	N/A	ISS
GO:0042744	GO-bp	Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005575	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cellular component	SoyBase	N/A	ISS
GO:0004497	GO-mf	Annotation by Michelle Graham. GO Molecular Function: monooxygenase activity	SoyBase	N/A	ISS
GO:0004499	GO-mf	Annotation by Michelle Graham. GO Molecular Function: N,N-dimethylaniline monooxygenase activity	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0050660	GO-mf	Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding	SoyBase	N/A	ISS
GO:0050661	GO-mf	Annotation by Michelle Graham. GO Molecular Function: NADP binding	SoyBase	N/A	ISS
KOG1399	KOG	Flavin-containing monooxygenase	JGI		ISS
PTHR23023	Panther	DIMETHYLANILINE MONOOXYGENASE	JGI		ISS
PTHR23023:SF5	Panther	MONOOXYGENASE	JGI		ISS
PF00743	PFAM	Flavin-binding monooxygenase-like	JGI		ISS
UniRef100_G7JYZ1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Dimethylaniline monooxygenase n=1 Tax=Medicago truncatula RepID=G7JYZ1_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JY26	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JY26_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g39160

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g39160

Paralog	Evidence	Comments
Glyma06g15810	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g39160 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g213600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g39160

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g39160

Limit To All Plant Sequences

>Glyma04g39160.1   sequence type=CDS   gene model=Glyma04g39160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGAAGTATCAGTGATAATCGTAGGTGCAGGTCCTTCTGGACTTGCAATTTCTGCATGCCTATCACAAAACTTTATCTCTCACATAATACTCGAGAAAGAGGATTGCAGTGCCTCTCTTTGGAGGAAAAACGCTTATGATAGATTAAAGCTCCATCTTGCTAGCGAGTTTTGTGTTTTGCCTCTCATGCCTCACCCACCCTCAGCCCCAACTTACCTATCCAAAGATGAATTTGTTCAATACATTGACTCGTACATTGCATGTTTCAACATAAACCCTCTCTATTGTCGTATGGTTGAGTTTGCTGCGTATGATGAAGTTGAAAACAAGTGGAGGGTCGAAGCGAAGAAGACTCTTGAGGGCACAAGTGAAACTTATGTGGCTAAGTTTCTTGTGATTGCCACGGGTGAAAATAGTGAAGGGTATATTCCTGATGTGCCTGGACTAGAAAGCTTTGAAGGAGAGATAGTGCACTCCAAATACTACAAATCGGGTTCAAAATATGAAACCAAAGAAGTTTTGGTAGTTGGGTGTGGTAACTCTGGGATGGAGATTGCTTATGATCTCAATGACTGGGGTGCAAACACTTCTATTCTCATCCGAAATCCGGTTCATGTCTTCACCAAAGAATTGATCAATGAAGGCATGCGAATGCTGAAGCATTTACCCGTTCATGTTGTGGACAATATCATTACCTCTTTGGCAAACATGGAATATGGTGATCTATCTAAGTACGGAATTTATCAGCCCAAAAAAGGACCCTTTCATCTTAAGTTTATAACTGGAAGGGCTCCAGTTATCGATGTTGGAACCATTGAAAAGATTAAGGAGGGAGCAATTAAGGTAATTCCTTCTCATATAGTGAGAATTGAAAACAAGAAGGTCATATTTGAAAACGATGCTGAAAAGGAGTTTGATGTAATCGTGTTTGCTACTGGCTACAGAAGTGTAGCTAATAAGTGGCTTAAGGATTACAAATATGTTCTAAATGATGAGGGGATGCCGAACAATGATTTTCCAAACCATTGGAAGGGTGATCGTGGATTATATTGTGCAGGACTATCAAACAGAGGCTTATTTGGAGTCAAAATGGATGTTGAGGCTATTGCTGATGACATCAACCAAACTCTCAAGTTACATTAA

Predicted protein sequences of Glyma04g39160

Limit To All Plant Sequences

>Glyma04g39160.1   sequence type=predicted peptide   gene model=Glyma04g39160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEVSVIIVGAGPSGLAISACLSQNFISHIILEKEDCSASLWRKNAYDRLKLHLASEFCVLPLMPHPPSAPTYLSKDEFVQYIDSYIACFNINPLYCRMVEFAAYDEVENKWRVEAKKTLEGTSETYVAKFLVIATGENSEGYIPDVPGLESFEGEIVHSKYYKSGSKYETKEVLVVGCGNSGMEIAYDLNDWGANTSILIRNPVHVFTKELINEGMRMLKHLPVHVVDNIITSLANMEYGDLSKYGIYQPKKGPFHLKFITGRAPVIDVGTIEKIKEGAIKVIPSHIVRIENKKVIFENDAEKEFDVIVFATGYRSVANKWLKDYKYVLNDEGMPNNDFPNHWKGDRGLYCAGLSNRGLFGVKMDVEAIADDINQTLKLH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain