SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g38291

Feature Type:gene_model
Chromosome:Gm04
Start:44689950
stop:44696142
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g38291
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G30390AT Annotation by Michelle Graham. TAIR10: ferrochelatase 2 | chr2:12951242-12953985 REVERSE LENGTH=512 SoyBaseE_val: 0ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006783GO-bp Annotation by Michelle Graham. GO Biological Process: heme biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019243GO-bp Annotation by Michelle Graham. GO Biological Process: methylglyoxal catabolic process to D-lactate SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019760GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate metabolic process SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0004325GO-mf Annotation by Michelle Graham. GO Molecular Function: ferrochelatase activity SoyBaseN/AISS
KOG1321 KOG Protoheme ferro-lyase (ferrochelatase) JGI ISS
PTHR11108Panther FERROCHELATASE JGI ISS
PF00762PFAM Ferrochelatase JGI ISS
UniRef100_I1KBS4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ferrochelatase n=1 Tax=Glycine max RepID=I1KBS4_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1KBS4UniRef Annotation by Michelle Graham. Best UniRef hit: Ferrochelatase n=1 Tax=Glycine max RepID=I1KBS4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g38291
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g38291 not represented in the dataset
Glyma04g38291 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g38291
ParalogEvidenceComments
Glyma06g16750 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g38291 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g205600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g38291
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g38291
>Glyma04g38291.1   sequence type=CDS   gene model=Glyma04g38291   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACACTCCAATTCATGCCCCTTCATCATCACCATCTTCTTCTTCTTCCTCCTACATGCTTCGTCCTCCTTCATGCCTCTCTCATCCTTCTCGTAACATCAAGTGTCCTATGTTGTTACCACAGGCAATTTGTACCTCTCAAAAGAAGTACTGGTGCTTCAGAGCTCATGTGGAGGCTTCTTTTAACACTAATCCCTTGAAAAATTACACATCAGTCAGTTGCTCTACATGGTGGTCTGAAGCACAATCCTTAGTTTCTTACAAAACACACAACAAACAGTTGTTCACTGTAGGATCTTTAGCAACTTCAACAGCTCAAGATGTTTCTGATACAACTCTTATTGGTGGTGATAAGATTGGCGTGTTACTGTTAAACCTTGGAGGTCCAGAGACTCTAGAAGATGTGCAGCCTTTTTTGTTTAACCTTTTTGCCGACCCGGATATAATACGTTTGCCAAGGATATTTAGTTTTCTTCAAAAGCCATTGGCTCAATTTGTATCTGTCGCAAGAGCCCCAAAGAGCAAAGAAGGCTATGCTTCAATTGGTGGTGGCTCTCCTCTCAGACGCATGACTGATGAACAGGCCGAGGAGTTGAAAAAATCTCTTTGGGAAAAGAATGTCCCTGCTAAAGTGTATGTTGGCATGCGTTACTGGCATCCTTTCACTGAAGAAGCTATTGAGCAGATTAAAAGGGATGGAATTACAAAGCTTGTTATTCTTCCACTCTATCCACAATTTTCAATATCAACGAGTGGCTCAAGCCTACGTCTACTGGAGAGTATATTCCGAGAGGATGAGTATCTAGTCAACATGCAGCACACAGTAATACCCTCATGGTATAAACGTGAAGGATACATAAAGGCCATGGCAAATTTAATTGAAAAAGAGCTGAAGAGTTTTGACTGCCCCGAGGAGGTCATGATATTCTTTAGTGCACATGGGGTGCCTCTTGCTTATGTGGAAGAGGCTGGTGATCCATACAAGGCTGAGATGGAAGAATGTGTGGATTTGATCATGGAAGAACTTGAGACACGAAAGATAACTAATGCTTGCACCCTTGCTTATCAGAGTAGAGTTGGACCAGTGGAATGGTTAAGACCCTATACAGACGAGACAATAGTTGAACTTGGAAAAAAGGGAGTGAAAAGTCTGCTCGCTGTTCCAATTAGCTTCGTCAGTGAGCATATTGAAACTCTAGAAGAAATTGATGTTGAATACAAAGAGTTGGCTCTAGAATCTGGTATAGAAAAGTGGGGCCGTGTTCCTGCTCTAGGATGCGAACCTACCTTCATTTCTGATTTGGCAGATGCCGTTATTGAGAGTCTCCCATATGTTGGTGCCATGACAGCTTCAGACCTTGAAGCTCAACAATCCCTCGTTCCACTGGGCAGTGTAGAAGAGTTATTGGCAGCATATGATTCACAACGCAGGGAGTTGCCACCACCAGTTATAGTGTGGGAATGGGGTTGGACAAAAAGTGCTGAAACTTGGAATGGAAGAGTAGCTATGCTTGCTGTGCTTCTTCTTTTGTTTTTTGAATTCACTGCAGACAAGGGTTTGCTGCACCAGATGGGAATATGGCCCTTGCTTAGATGA
Predicted protein sequences of Glyma04g38291
>Glyma04g38291.1   sequence type=predicted peptide   gene model=Glyma04g38291   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNTPIHAPSSSPSSSSSSYMLRPPSCLSHPSRNIKCPMLLPQAICTSQKKYWCFRAHVEASFNTNPLKNYTSVSCSTWWSEAQSLVSYKTHNKQLFTVGSLATSTAQDVSDTTLIGGDKIGVLLLNLGGPETLEDVQPFLFNLFADPDIIRLPRIFSFLQKPLAQFVSVARAPKSKEGYASIGGGSPLRRMTDEQAEELKKSLWEKNVPAKVYVGMRYWHPFTEEAIEQIKRDGITKLVILPLYPQFSISTSGSSLRLLESIFREDEYLVNMQHTVIPSWYKREGYIKAMANLIEKELKSFDCPEEVMIFFSAHGVPLAYVEEAGDPYKAEMEECVDLIMEELETRKITNACTLAYQSRVGPVEWLRPYTDETIVELGKKGVKSLLAVPISFVSEHIETLEEIDVEYKELALESGIEKWGRVPALGCEPTFISDLADAVIESLPYVGAMTASDLEAQQSLVPLGSVEELLAAYDSQRRELPPPVIVWEWGWTKSAETWNGRVAMLAVLLLLFFEFTADKGLLHQMGIWPLLR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo