Report for Sequence Feature Glyma04g37191
Feature Type: gene_model
Chromosome: Gm04
Start: 43588093
stop: 43597193
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g37191
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G24890 AT
Annotation by Michelle Graham. TAIR10: purple acid phosphatase 24 | chr4:12811510-12814440 REVERSE LENGTH=615
SoyBase E_val: 9.00E-109 ISS
GO:0016036 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation
SoyBase N/A ISS
GO:0019375 GO-bp
Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process
SoyBase N/A ISS
GO:0045892 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005576 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: extracellular region
SoyBase N/A ISS
GO:0005618 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cell wall
SoyBase N/A ISS
GO:0003993 GO-mf
Annotation by Michelle Graham. GO Molecular Function: acid phosphatase activity
SoyBase N/A ISS
GO:0004722 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity
SoyBase N/A ISS
GO:0016787 GO-mf
Annotation by Michelle Graham. GO Molecular Function: hydrolase activity
SoyBase N/A ISS
GO:0046872 GO-mf
Annotation by Michelle Graham. GO Molecular Function: metal ion binding
SoyBase N/A ISS
PTHR22953 Panther
ACID PHOSPHATASE RELATED
JGI ISS
PF00149 PFAM
Calcineurin-like phosphoesterase
JGI ISS
UniRef100_G0T440 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Purple acid phosphatases n=1 Tax=Glycine max RepID=G0T440_SOYBN
SoyBase E_val: 7.00E-125 ISS
UniRef100_I1JXJ9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JXJ9_SOYBN
SoyBase E_val: 2.00E-180 ISS
Expression Patterns of Glyma04g37191
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma04g37191
Paralog Evidence Comments
Glyma06g17860 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma04g37191 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
References for Glyma04g37191
Coding sequences of Glyma04g37191
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g37191.1 sequence type=CDS gene model=Glyma04g37191 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGCCTTATGCAAATGGATACACCTCACAGGGAGACCAATTCACAGCTCAAGTGCAAGAAATTTCGTCAACAGTACCATACATAATCGCAAGTGGAAATCATGAACGTGACTGGCCAAACACAGGATCACTTTTTGATACTCCAGATTCAGGTGGAGAATGTGGAGTTTTTGCAGAAACCATGTATTATTTTCCTGCTGAGAATAGAGCCAAATTCTGGTATAAGGCAGATTATGGCCTGTTTCGTTTCTGTGTAGCAGATAGTGAGCACGACTGGAGAGAAGGATCAGAACAATACAAATTCATTGAGCATTGTCTTGCAACTATAGATAGAAAGCATCAACCATGGCTAATCTTTTCGGCTCATCGTCCCCTTGACTACTCATCTAATGATTGGTATGGCAAGGAAGGCTCATTTGAAGAGCCAATGGGAAGGGAAAGTTTGCAGAAGCTTTGGCAAAAGTACAAAGTAGAAATTCCATTTTATGGTCACGTCCATAACTATGAAAGAATGTGCCCCATTTATCAGAATCAATGTGTGAATCAAGAAAAGCATCAATTACTCTGGCACTGTGAACGGAACAATTCATGTGGTTGTTGGTGGTGGGGGAAGTCACTTGTCAGACTTCACACCAACACCCCCTATTTGGAGTCTTTACAGGGATCTCTCGACTATGGGTTTGGCAAATTGACTGGCATTCAATCATTCATATCTCTTGTTTGA
Predicted protein sequences of Glyma04g37191
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g37191.1 sequence type=predicted peptide gene model=Glyma04g37191 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MPYANGYTSQGDQFTAQVQEISSTVPYIIASGNHERDWPNTGSLFDTPDSGGECGVFAETMYYFPAENRAKFWYKADYGLFRFCVADSEHDWREGSEQYKFIEHCLATIDRKHQPWLIFSAHRPLDYSSNDWYGKEGSFEEPMGRESLQKLWQKYKVEIPFYGHVHNYERMCPIYQNQCVNQEKHQLLWHCERNNSCGCWWWGKSLVRLHTNTPYLESLQGSLDYGFGKLTGIQSFISLV*