Glyma04g36930 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g36930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g36930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g36930

Feature Type:	gene_model
Chromosome:	Gm04
Start:	43422408
stop:	43425748
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g36930

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G34412	AT	Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Kinase binding protein CGI-121 (InterPro:IPR013926); Has 275 Blast hits to 275 proteins in 139 species: Archae - 0; Bacteria - 5; Metazoa - 98; Fungi - 109; Plants - 42; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). \| chr4:16453099-16454515 REVERSE LENGTH=172	SoyBase	E_val: 3.00E-86	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG4066	KOG	Cell growth regulatory protein CGR11	JGI		ISS
PTHR15840	Panther	CGI-121 FAMILY MEMBER	JGI		ISS
PTHR15840:SF4	Panther	gb def: w03f8.4.p [caenorhabditis elegans]	JGI		ISS
PF08617	PFAM	Kinase binding protein CGI-121	JGI		ISS
UniRef100_B6TUM9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: PRPK n=1 Tax=Zea mays RepID=B6TUM9_MAIZE	SoyBase	E_val: 9.00E-75	ISS
UniRef100_C6T568	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T568_SOYBN	SoyBase	E_val: 6.00E-120	ISS

Expression Patterns of Glyma04g36930

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g36930 not represented in the dataset	Glyma04g36930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g36930

Paralog	Evidence	Comments
Glyma06g18050	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g36930 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g194000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g36930

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g36930

Limit To All Plant Sequences

>Glyma04g36930.1   sequence type=CDS   gene model=Glyma04g36930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAATCGTTCAATATAAATGGAACCACTCTTTCTGTTGCACTCTACACTGACGTAACAAATTCAAAAGAACTCTTGGAAAGTATGCAAGCCGGGACATTGGAGCCAGAAGTTGCATTCCTCAATGCTTTACTTATTCCAGATATTTTCCCTGTTCTAGCAGCTGCACACAAAACACTTGTAGCCAAGTCTCGAGACTCTTTGACCACACGCACTCTTCATTCAGAGCTTGTTTACAACTACTCAGGGTCTAAGCATATTACTGAATCTTTGAAAAGATGCGGCATCTCTGACAGCACAACTTGTATCCTTGCTGCTCGATTTGATGCTAGTCCTGATGAGATAAAAGCTATAGGGAAGCTCATTAACGGCAAAGAGATTGACCTGGAGGAGCTAGAAGGGAGAGCAAACCAATCCCAGATACAAAAGATTTACAAGATATCTTCCTCGGAACTTGGAGTATCATCACTTGCTGATGCAATAACTTGTCGTATAGCTGCTCGTGATGCCCTGTGA

Predicted protein sequences of Glyma04g36930

Limit To All Plant Sequences

>Glyma04g36930.1   sequence type=predicted peptide   gene model=Glyma04g36930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKSFNINGTTLSVALYTDVTNSKELLESMQAGTLEPEVAFLNALLIPDIFPVLAAAHKTLVAKSRDSLTTRTLHSELVYNYSGSKHITESLKRCGISDSTTCILAARFDASPDEIKAIGKLINGKEIDLEELEGRANQSQIQKIYKISSSELGVSSLADAITCRIAARDAL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain