SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g36870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g36870): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g36870

Feature Type:gene_model
Chromosome:Gm04
Start:43365888
stop:43368623
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g36870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G04120AT Annotation by Michelle Graham. TAIR10: glyceraldehyde-3-phosphate dehydrogenase C subunit 1 | chr3:1081077-1083131 FORWARD LENGTH=338 SoyBaseE_val: 0ISS
GO:0006006GO-bp Annotation by Michelle Graham. GO Biological Process: glucose metabolic process SoyBaseN/AISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009060GO-bp Annotation by Michelle Graham. GO Biological Process: aerobic respiration SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048316GO-bp Annotation by Michelle Graham. GO Biological Process: seed development SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005740GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial envelope SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004365GO-mf Annotation by Michelle Graham. GO Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0008886GO-mf Annotation by Michelle Graham. GO Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (NADP+) (non-phosphorylating) activity SoyBaseN/AISS
GO:0016620GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050661GO-mf Annotation by Michelle Graham. GO Molecular Function: NADP binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG0657 KOG Glyceraldehyde 3-phosphate dehydrogenase JGI ISS
PTHR10836Panther GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE JGI ISS
PF00044PFAM Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain JGI ISS
PF02800PFAM Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain JGI ISS
UniRef100_I1JXH1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=3 Tax=Glycine max RepID=I1JXH1_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q2I0H4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glyceraldehyde-3-phosphate dehydrogenase n=3 Tax=Glycine max RepID=Q2I0H4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g36870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g36870 not represented in the dataset
Glyma04g36870 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g36870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g193500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g36870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g36870
>Glyma04g36870.3   sequence type=CDS   gene model=Glyma04g36870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTATCCGATTCACTTGGCCTATTTACCTATCACTGCGGTCTTTTACTCTTCTACTGCCTTCTTAAAACCCTATCTCTCACCAACTTCCGCTACTTCCTACTCCAACCACTTTCTTTTTTCCCGCAGTCATGGGTATGCAAATAACCACCACACACTCACCGTTTTCTTTTCATTTTCAACTCTACACTCCGTTTCTTCCGATGTGATTTTTCTTCTTCTTTCTTTTCTGATATTTGTTTTGTTTTCAAATGAATTGCATGGATCAGGCAAGGTCAAGATCGGAATCAACGGATTTGGAAGAATTGGCCGTTTGGTGGCCAGGGTGGCTCTGCAGAGAGACGATGTTGAACTCGTTGCCGTTAACGATCCTTTCATTACCACCGATTACATGACATACATGTTTAAATACGACAGTGTTCACGGGCACTGGAAGCATCACGATGTCACCGTTAAGGATGAGAAGACCCTTCTCTTCGGTGACAAGCCAGTCACTGTTTTTGGACACAGGAACCCTGAAGAGATCCCATGGAAGTCGACTGGAGCTGACATCATTGTTGAGTCCACCGGAGTTTTCACCGATAAGGATAAGGCTGCCGCACATTTGAAGGGTGGTGCAAAGAAGGTTATTATTTCTGCCCCCAGTAAGGATGCCCCCATGTTTGTTGTTGGTGTTAACGAGCACGAGTACAAGCCAGAGCTTGACATTATTTCCAATGCTAGCTGCACAACCAACTGCCTTGCCCCGCTCGCCAAGGTTATCAATGACAGGTTTGGCATTGTTGAGGGTTTGATGACCACTGTTCATTCCATCACTGCTACCCAGAAGACTGTTGATGGGCCATCAGCCAAAGACTGGAGAGGTGGAAGAGCTGCTTCATTTAACATCATTCCTAGCAGCACTGGAGCTGCCAAGGCTGTTGGAAAAGTCCTCCCTGCTTTGAATGGAAAATTGACTGGTATGGCATTCCGTGTTCCCACTGTGGATGTCTCTGTTGTTGACCTCACAGTGAGGCTGGAGAAGGAAGCCTCCTACGATGAAATTAAAAATGCTATCAAGGAGGAATCAGAGGGCAAGTTGAAGGGAATTCTTGGTTACACTGAAGATGATGTGGTCTCCACCGACTTTGTGGGCGATAGCAGATCAAGTATTTTTGATGCAAAGGCTGGAATTGCATTGAATAAGAACTTTGTGAAGCTTGTTTCTTGGTACGACAACGAGTGGGGATACAGCTCACGTGTCATTGACCTGCTTGTATTCGTTGCCAAGAAGTCTTTTTAA
Predicted protein sequences of Glyma04g36870
>Glyma04g36870.3   sequence type=predicted peptide   gene model=Glyma04g36870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYPIHLAYLPITAVFYSSTAFLKPYLSPTSATSYSNHFLFSRSHGYANNHHTLTVFFSFSTLHSVSSDVIFLLLSFLIFVLFSNELHGSGKVKIGINGFGRIGRLVARVALQRDDVELVAVNDPFITTDYMTYMFKYDSVHGHWKHHDVTVKDEKTLLFGDKPVTVFGHRNPEEIPWKSTGADIIVESTGVFTDKDKAAAHLKGGAKKVIISAPSKDAPMFVVGVNEHEYKPELDIISNASCTTNCLAPLAKVINDRFGIVEGLMTTVHSITATQKTVDGPSAKDWRGGRAASFNIIPSSTGAAKAVGKVLPALNGKLTGMAFRVPTVDVSVVDLTVRLEKEASYDEIKNAIKEESEGKLKGILGYTEDDVVSTDFVGDSRSSIFDAKAGIALNKNFVKLVSWYDNEWGYSSRVIDLLVFVAKKSF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo