SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g36860

Feature Type:gene_model
Chromosome:Gm04
Start:43359207
stop:43362256
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g36860
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G13440AT Annotation by Michelle Graham. TAIR10: glyceraldehyde-3-phosphate dehydrogenase C2 | chr1:4608465-4610494 REVERSE LENGTH=338 SoyBaseE_val: 0ISS
GO:0006006GO-bp Annotation by Michelle Graham. GO Biological Process: glucose metabolic process SoyBaseN/AISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0051049GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transport SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004365GO-mf Annotation by Michelle Graham. GO Molecular Function: glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG0657 KOG Glyceraldehyde 3-phosphate dehydrogenase JGI ISS
PTHR10836Panther GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE JGI ISS
PF00044PFAM Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain JGI ISS
PF02800PFAM Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain JGI ISS
UniRef100_Q2I0H4UniRef Annotation by Michelle Graham. Best UniRef hit: Glyceraldehyde-3-phosphate dehydrogenase n=3 Tax=Glycine max RepID=Q2I0H4_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q2I0H4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glyceraldehyde-3-phosphate dehydrogenase n=3 Tax=Glycine max RepID=Q2I0H4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g36860
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g36860
ParalogEvidenceComments
Glyma06g18110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g36860 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g193400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g36860
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Transcripts of Glyma04g36860
>Glyma04g36860.3   sequence type=transcript   gene model=Glyma04g36860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACCCTTCTTTCAACCTTTATTAAAACCCTATCTCACTCACTCTCACCCACACACCGTTTGTTCTATTCTTAACTCAACTTCTGCTACCCACTCTCTTCTTCCAAGTCCAACCACGCTTTTCTCTACAGTCATGGGCAAGGTCAAGATCGGAATCAACGGATTTGGAAGAATTGGCCGTTTGGTTGCCAGAGTCGCTCTGCAAAGAGACGATGTGGAGCTCGTTGCCGTTAACGACCCTTTCATTACCACCGATTACATGACATACATGTTTAAATACGACAGTGTTCACGGACACTGGAAGCATCACGATGTCACCGTTAAGGACGAGAAGACCCTTCTCTTCGGTGACAAGCCAGTCACTGTTTTTGGACACAGGAACCCTGAAGAGATCCCATGGGGGTCAACTGGAGCTGATATCATTGTTGAGTCCACCGGAGTTTTCACCGATAAGGACAAGGCCGCCGCACATTTGAAGGGTGGTGCGAAGAAGGTTATTATTTCTGCCCCCAGTAAGGATGCCCCCATGTTTGTTGTTGGTGTTAACGAGCACGAGTACAAGCCAGAGCTTGATATTATTTCCAATGCTAGCTGCACAACCAACTGCCTTGCTCCACTTGCTAAGGTTTCATATTCTGGACAATTCTAACATGTTGATTTTGAATTTTT
Coding sequences of Glyma04g36860
>Glyma04g36860.1   sequence type=CDS   gene model=Glyma04g36860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCAAGGTCAAGATCGGAATCAACGGATTTGGAAGAATTGGCCGTTTGGTTGCCAGAGTCGCTCTGCAAAGAGACGATGTGGAGCTCGTTGCCGTTAACGACCCTTTCATTACCACCGATTACATGACATACATGTTTAAATACGACAGTGTTCACGGACACTGGAAGCATCACGATGTCACCGTTAAGGACGAGAAGACCCTTCTCTTCGGTGACAAGCCAGTCACTGTTTTTGGACACAGGAACCCTGAAGAGATCCCATGGGGGTCAACTGGAGCTGATATCATTGTTGAGTCCACCGGAGTTTTCACCGATAAGGACAAGGCCGCCGCACATTTGAAGGGTGGTGCGAAGAAGGTTATTATTTCTGCCCCCAGTAAGGATGCCCCCATGTTTGTTGTTGGTGTTAACGAGCACGAGTACAAGCCAGAGCTTGATATTATTTCCAATGCTAGCTGCACAACCAACTGCCTTGCTCCACTTGCTAAGGTTATTAATGACAGGTTTGGCATTGTTGAGGGTTTGATGACCACTGTTCATTCCATCACTGCCACCCAGAAGACTGTTGATGGGCCATCAGCCAAAGACTGGAGAGGTGGAAGAGCTGCTTCATTTAACATCATTCCTAGCAGCACTGGAGCTGCCAAGGCTGTTGGAAAAGTCCTTCCTGCTTTGAACGGAAAATTGACTGGTATGGCATTCCGTGTTCCCACCGTGGATGTCTCTGTTGTTGACCTCACAGTGAGGCTGGAGAAGGAAGCCTCCTACGATGAAATTAAAAATGCTATCAAGGAGGAATCAGAGGGCAAGTTGAAGGGAATTCTTGGTTACACTGAAGATGATGTGGTCTCCACCGACTTTGTGGGCGATAGCAGATCAAGTATTTTTGATGCAAAGGCTGGAATTGCATTGAATAAGAACTTTGTGAAGCTTGTCTCTTGGTATGACAACGAGTGGGGATACAGCTCACGTGTCATTGACCTGCTTGTATTCGTTGCCAAGAAGTCTTTTTAA

>Glyma04g36860.3   sequence type=CDS   gene model=Glyma04g36860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCAAGGTCAAGATCGGAATCAACGGATTTGGAAGAATTGGCCGTTTGGTTGCCAGAGTCGCTCTGCAAAGAGACGATGTGGAGCTCGTTGCCGTTAACGACCCTTTCATTACCACCGATTACATGACATACATGTTTAAATACGACAGTGTTCACGGACACTGGAAGCATCACGATGTCACCGTTAAGGACGAGAAGACCCTTCTCTTCGGTGACAAGCCAGTCACTGTTTTTGGACACAGGAACCCTGAAGAGATCCCATGGGGGTCAACTGGAGCTGATATCATTGTTGAGTCCACCGGAGTTTTCACCGATAAGGACAAGGCCGCCGCACATTTGAAGGGTGGTGCGAAGAAGGTTATTATTTCTGCCCCCAGTAAGGATGCCCCCATGTTTGTTGTTGGTGTTAACGAGCACGAGTACAAGCCAGAGCTTGATATTATTTCCAATGCTAGCTGCACAACCAACTGCCTTGCTCCACTTGCTAAGGTTTCATATTCTGGACAATTCTAA
Predicted protein sequences of Glyma04g36860
>Glyma04g36860.1   sequence type=predicted peptide   gene model=Glyma04g36860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKVKIGINGFGRIGRLVARVALQRDDVELVAVNDPFITTDYMTYMFKYDSVHGHWKHHDVTVKDEKTLLFGDKPVTVFGHRNPEEIPWGSTGADIIVESTGVFTDKDKAAAHLKGGAKKVIISAPSKDAPMFVVGVNEHEYKPELDIISNASCTTNCLAPLAKVINDRFGIVEGLMTTVHSITATQKTVDGPSAKDWRGGRAASFNIIPSSTGAAKAVGKVLPALNGKLTGMAFRVPTVDVSVVDLTVRLEKEASYDEIKNAIKEESEGKLKGILGYTEDDVVSTDFVGDSRSSIFDAKAGIALNKNFVKLVSWYDNEWGYSSRVIDLLVFVAKKSF*

>Glyma04g36860.3   sequence type=predicted peptide   gene model=Glyma04g36860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKVKIGINGFGRIGRLVARVALQRDDVELVAVNDPFITTDYMTYMFKYDSVHGHWKHHDVTVKDEKTLLFGDKPVTVFGHRNPEEIPWGSTGADIIVESTGVFTDKDKAAAHLKGGAKKVIISAPSKDAPMFVVGVNEHEYKPELDIISNASCTTNCLAPLAKVSYSGQF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo