SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g36500

Feature Type:gene_model
Chromosome:Gm04
Start:43007446
stop:43010415
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g36500
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48360AT Annotation by Michelle Graham. TAIR10: BTB and TAZ domain protein 2 | chr3:17908482-17910471 REVERSE LENGTH=364 SoyBaseE_val: 4.00E-120ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007623GO-bp Annotation by Michelle Graham. GO Biological Process: circadian rhythm SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009553GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac development SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009734GO-bp Annotation by Michelle Graham. GO Biological Process: auxin mediated signaling pathway SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009743GO-bp Annotation by Michelle Graham. GO Biological Process: response to carbohydrate stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0051973GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of telomerase activity SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0003712GO-mf Annotation by Michelle Graham. GO Molecular Function: transcription cofactor activity SoyBaseN/AISS
GO:0004402GO-mf Annotation by Michelle Graham. GO Molecular Function: histone acetyltransferase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005516GO-mf Annotation by Michelle Graham. GO Molecular Function: calmodulin binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG1778 KOG CREB binding protein/P300 and related TAZ Zn-finger proteins JGI ISS
PTHR24413Panther FAMILY NOT NAMED JGI ISS
PTHR24413:SF192Panther JGI ISS
PF00651PFAM BTB/POZ domain JGI ISS
PF02135PFAM TAZ zinc finger JGI ISS
UniRef100_G7JMM8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Speckle-type POZ protein n=1 Tax=Medicago truncatula RepID=G7JMM8_MEDTR SoyBaseE_val: 9.00E-163ISS
UniRef100_UPI000233A986UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A986 related cluster n=1 Tax=unknown RepID=UPI000233A986 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g36500
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g36500 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g190900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g36500
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g36500
>Glyma04g36500.2   sequence type=CDS   gene model=Glyma04g36500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATTCCCCTGCAGTTTCCTCTATCCACTTTCACAACGCCCATGTCTTACCCGAACCAGACCTTTTTATGCACACTCCCGGTGGTAACCGCATTCCAGCGCACGCAACCATTCTGGCTTCGGCATCCCCAGTTTTAGAAAACGTCATTGCGTCCAACCGAGTCGTCAAAATCCACGGCGTTCCCGACGGCGCCGTCACGGCCTTCGTAGCGTTCCTCTACTCCTCCAGGTGCACGGAGGAGGACATGGACAAGTACGGAATCCACCTTCTAGCATTGTCGCACGTGTATTCGGTGCCGCAGCTGAAGCAGAGGTGCATCAAGGGACTGGCCCAGCGCTTGAGCACGGAGAACGTGGTGGACGTGTTGCAACTCTCTCGGCTCTGCGACGCACCGGATCTCTACCTCAAGTGCGTGAAGCTCCTCAGGAACCGTTTCAAAGCCGTGAAGGAAACAGAGGGCTGGAAATTCCTCGAGAGCCACGACCCCTGGCTCGAACTCGACGTTCTCCGCCTCATGGGCGAACTCGAAAAGAGGAAGAGGAGGGTGAGGAAGTGGAGGGAGGAGGAGAGGTTGTACGTGCAGCTGAGCGAGGCGATGGAGTGTTTGGAGCACATATGCACGGAGGGGTGTACGGAGGTGGGGCCATACGAGGTGGAGGTTGGACGACAAAAAACGCCGTGCTCAAAGTTCGCCACGTGTCAGGGTTTGCAGGTGTTGATACGACACTTGGGAACTTGCAACAGGAAGCTCAAAGGAGGGTGTTTGCGGTGTAAGCGTATGTGGCAGCTCTTCAGGCTCCACTCCTCCATTTGCCTATGCCAGAATTCATGCAAGGTTCCTCTTTGCAGGCAAATTCGATTAAAAATGGAGCAAGAGAACATGAAAGATGACGCAAGGTGGAAACTACTGGTGAGGAAGGTGGCCTCGGCCAAAGCCTTGTCTTCCTTGGCGCTGCCAAAGAGGAAATTAGATCAGAGCTAG
Predicted protein sequences of Glyma04g36500
>Glyma04g36500.2   sequence type=predicted peptide   gene model=Glyma04g36500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDSPAVSSIHFHNAHVLPEPDLFMHTPGGNRIPAHATILASASPVLENVIASNRVVKIHGVPDGAVTAFVAFLYSSRCTEEDMDKYGIHLLALSHVYSVPQLKQRCIKGLAQRLSTENVVDVLQLSRLCDAPDLYLKCVKLLRNRFKAVKETEGWKFLESHDPWLELDVLRLMGELEKRKRRVRKWREEERLYVQLSEAMECLEHICTEGCTEVGPYEVEVGRQKTPCSKFATCQGLQVLIRHLGTCNRKLKGGCLRCKRMWQLFRLHSSICLCQNSCKVPLCRQIRLKMEQENMKDDARWKLLVRKVASAKALSSLALPKRKLDQS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo