SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g36250

Feature Type:gene_model
Chromosome:Gm04
Start:42801581
stop:42803672
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g36250
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G20360AT Annotation by Michelle Graham. TAIR10: RAB GTPase homolog E1B | chr4:10990036-10991466 FORWARD LENGTH=476 SoyBaseE_val: 0ISS
GO:0000038GO-bp Annotation by Michelle Graham. GO Biological Process: very long-chain fatty acid metabolic process SoyBaseN/AISS
GO:0006414GO-bp Annotation by Michelle Graham. GO Biological Process: translational elongation SoyBaseN/AISS
GO:0018119GO-bp Annotation by Michelle Graham. GO Biological Process: peptidyl-cysteine S-nitrosylation SoyBaseN/AISS
GO:0042335GO-bp Annotation by Michelle Graham. GO Biological Process: cuticle development SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0009295GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleoid SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003746GO-mf Annotation by Michelle Graham. GO Molecular Function: translation elongation factor activity SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG0460 KOG Mitochondrial translation elongation factor Tu JGI ISS
PTHR23115Panther TRANSLATION FACTOR JGI ISS
PTHR23115:SF31Panther ELONGATION FACTOR TU (EF-TU) JGI ISS
PF00009PFAM Elongation factor Tu GTP binding domain JGI ISS
PF03143PFAM Elongation factor Tu C-terminal domain JGI ISS
PF03144PFAM Elongation factor Tu domain 2 JGI ISS
UniRef100_I1JXC1UniRef Annotation by Michelle Graham. Best UniRef hit: Elongation factor Tu n=1 Tax=Glycine max RepID=I1JXC1_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1JXC1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Elongation factor Tu n=1 Tax=Glycine max RepID=I1JXC1_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g36250
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g36250
ParalogEvidenceComments
Glyma06g18640 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g36250 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g188700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g36250
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g36250
>Glyma04g36250.1   sequence type=CDS   gene model=Glyma04g36250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGTTTCTTCTGCATCTGCTTCCTCCAAACTTATACTATTCCCCCATGCTTCATCTTCTTCCCTTATCTCCACACCCTTCCGTTCCTCCACCAACACCCACAAACTATCCCCTCTCTCCTCCTCCTTCCTCCACCCCACCACCGTCCTCCGCCGCACCCCCTCCTCCACCACTACCACCACCTCCCCGCGCCGCCCCCTCACCGTCCGCGCCGCCCGCGGCAAGTTCGAGCGCAAGAAGCCCCACGTGAACATCGGCACCATCGGCCACGTGGACCACGGCAAGACCACCCTGACCGCCGCCCTCACCATGGCCCTTGCCGCCCTCGGCAACAGCGCCCCGAAGAAGTACGACGAGATCGACGCCGCCCCGGAGGAACGCGCCCGCGGCATCACCATCAACACCGCCACCGTCGAGTACGAGACCGAGAACCGCCACTACGCCCACGTGGACTGCCCCGGCCACGCCGACTACGTCAAGAACATGATCACCGGCGCCGCCCAGATGGACGGCGCCATCCTTGTCGTCTCCGGCGCCGACGGCCCCATGCCCCAAACCAAAGAACACATCCTCTTAGCCAAGCAAGTCGGTGTCCCCAACATGGTCGTCTTCCTCAACAAGCAAGACCAAGTCGACGACGAAGAGCTTCTCCAACTAGTCGAACTCGAAGTTCGCGACCTTCTTACCTCCTACGAATTCCCCGGTGACGATACCCCCATCGTCTCCGGCTCCGCACTCTTAGCCCTAGAAGCCCTTATGGCGAACCCTGCCATCAAACGCGGCGACAACGAGTGGGTCGACAAAATCTACAAACTCATGGACGAAGTCGACGACTACATTCCCATCCCCCAGCGCCAGACCGACCTCCCATTCCTCCTCGCCGTCGAAGACGTTTTCTCCATCACCGGCCGTGGGACCGTCGCCACCGGCCGCGTAGAGCGTGGCACCGTCAAAGTAGGGGAAACTGTTGACCTTGTAGGATTGAGAGAGACAAGAAACACAACGGTCACAGGTGTGGAAATGTTCCAGAAGATTCTAGACGAAGCCCTCGCCGGGGACAACGTGGGGCTGTTGCTGAGAGGGGTTCAAAAGACGGACATCCAGAGAGGGATGGTGTTGGCGAAGCCTGGCACGATTACGCCGCACACCAAGTTCTCAGCGATTGTGTATGTTTTGAAGAAGGAAGAAGGTGGGAGACATTCACCTTTCTTTGCAGGGTATAGGCCTCAGTTTTACATGAGGACCACCGATGTGACTGGGAAGGTTACGGCTATCACCAACGATAGGGATGAAGAGTCGCAGATGGTGATGCCCGGTGACCGTGTGAAGATGGTGGTGGAGCTCATTGTGCCTGTGGCTTGCGAACAGGGAATGAGGTTTGCTATTAGGGAAGGTGGCAAGACCGTTGGTGCAGGTGTTATCCAATCCATCATTGAGTGA
Predicted protein sequences of Glyma04g36250
>Glyma04g36250.1   sequence type=predicted peptide   gene model=Glyma04g36250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVSSASASSKLILFPHASSSSLISTPFRSSTNTHKLSPLSSSFLHPTTVLRRTPSSTTTTTSPRRPLTVRAARGKFERKKPHVNIGTIGHVDHGKTTLTAALTMALAALGNSAPKKYDEIDAAPEERARGITINTATVEYETENRHYAHVDCPGHADYVKNMITGAAQMDGAILVVSGADGPMPQTKEHILLAKQVGVPNMVVFLNKQDQVDDEELLQLVELEVRDLLTSYEFPGDDTPIVSGSALLALEALMANPAIKRGDNEWVDKIYKLMDEVDDYIPIPQRQTDLPFLLAVEDVFSITGRGTVATGRVERGTVKVGETVDLVGLRETRNTTVTGVEMFQKILDEALAGDNVGLLLRGVQKTDIQRGMVLAKPGTITPHTKFSAIVYVLKKEEGGRHSPFFAGYRPQFYMRTTDVTGKVTAITNDRDEESQMVMPGDRVKMVVELIVPVACEQGMRFAIREGGKTVGAGVIQSIIE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo