Glyma04g35410 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g35410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g35410): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g35410

Feature Type:	gene_model
Chromosome:	Gm04
Start:	41781128
stop:	41785136
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g35410

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G48190	AT	Annotation by Michelle Graham. TAIR10: ataxia-telangiectasia mutated \| chr3:17797628-17828361 FORWARD LENGTH=3845	SoyBase	E_val: 3.00E-129	ISS
GO:0000003	GO-bp	Annotation by Michelle Graham. GO Biological Process: reproduction	SoyBase	N/A	ISS
GO:0000724	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination	SoyBase	N/A	ISS
GO:0006259	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA metabolic process	SoyBase	N/A	ISS
GO:0006281	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA repair	SoyBase	N/A	ISS
GO:0006310	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA recombination	SoyBase	N/A	ISS
GO:0006325	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromatin organization	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007059	GO-bp	Annotation by Michelle Graham. GO Biological Process: chromosome segregation	SoyBase	N/A	ISS
GO:0007062	GO-bp	Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion	SoyBase	N/A	ISS
GO:0007129	GO-bp	Annotation by Michelle Graham. GO Biological Process: synapsis	SoyBase	N/A	ISS
GO:0007131	GO-bp	Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination	SoyBase	N/A	ISS
GO:0009887	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ morphogenesis	SoyBase	N/A	ISS
GO:0009888	GO-bp	Annotation by Michelle Graham. GO Biological Process: tissue development	SoyBase	N/A	ISS
GO:0010090	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis	SoyBase	N/A	ISS
GO:0010212	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ionizing radiation	SoyBase	N/A	ISS
GO:0010332	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gamma radiation	SoyBase	N/A	ISS
GO:0010638	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization	SoyBase	N/A	ISS
GO:0032204	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance	SoyBase	N/A	ISS
GO:0032504	GO-bp	Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction	SoyBase	N/A	ISS
GO:0033044	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization	SoyBase	N/A	ISS
GO:0042138	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation	SoyBase	N/A	ISS
GO:0043247	GO-bp	Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage	SoyBase	N/A	ISS
GO:0043687	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-translational protein modification	SoyBase	N/A	ISS
GO:0045132	GO-bp	Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation	SoyBase	N/A	ISS
GO:0045893	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0000285	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 1-phosphatidylinositol-3-phosphate 5-kinase activity	SoyBase	N/A	ISS
GO:0004674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
GO:0016773	GO-mf	Annotation by Michelle Graham. GO Molecular Function: phosphotransferase activity, alcohol group as acceptor	SoyBase	N/A	ISS
UniRef100_G7J5F6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine protein kinase ATM n=1 Tax=Medicago truncatula RepID=G7J5F6_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JX71	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JX71_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g35410

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g35410 not represented in the dataset	Glyma04g35410 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g35410 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g35410

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g35410

Limit To All Plant Sequences

>Glyma04g35410.2   sequence type=CDS   gene model=Glyma04g35410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAAAGTCACTTCCAGAGACGTGCAAGAGATCGTGGAAAAACTCTCCTCCGATAAAGCCAAAGCTCGCGAAGAAGGGATCAAGTTGTTAAACACTTGGTTAGAAGGAGAAAGATCATATAACTTCTGCAAATTTATTGGATCAAATACTGCAAAGCTTAGGCCAGATGAAGTTCCTCATTCTGAAACATGGCCTTTTCTTATTTCTTTACTAATTAAATCTGCATCGGCGGAGATATCCTCAAGTAAGCGGAGAAATCCAAAAATGATATATGCAAAGACTCTTAGAATTGTTGTGCAACGTGCGGAGGATGCCAAGTGTTCAGGAAAAATGTTACCATTGTCATCTGTAGTTAAACCACTTTTCAATCATGTTTGGGATGTTCTGAGCAATGTTCCAAGCTTTCAGTCTGAATATGGGATTATCCTTCGGCATCTATTGTCAGTTAGAGATTATAGTTTCCAGATGAGGAAGCGCATATACTGCAACCTGGTGTTTCTGTACATTGAGAAAGTGGAAGCAAGCTTGAATGGAAAAAATATTAGCAATTGTACTTCCAAGGAGGAGGTCTTCCGCTATATCTTGACACTTCATTCTCTTTTAAAGTATCCTCCTGGAGACTACCCTGATAATGCAAGAGAAGACATTGTGAAGGGGTTTGTTAGAATATGTTCATTCATCAGGGAAGAGGGGAAGATATCACGTAAACTTGTTGAGTGTATTAATACATATTTATTAAATGATGGTCCAAATTTGGGCTTTCAGTTGTTTGAGATTCATAATGCCATGCAACAGTTTGTGTTCCGCAGTTGGCTGACAACACATGATCGAGTTCTCAAGGATTCACTTGTGTTCTATGCAAGGATTCAGTTGAATTTAATCAGTGGTGCTGCTGATAGGTGTTTATTGGTAGAACAGCTTTTGGATGTGATTTGTAAGGATCTTGATCAAGGTAGCATGTCTAGTACTTCAATGCTGCGGGGTGATGGGAATAAAGATGACAAATTAGGAGCTTTGAGTAGCTCACAATGTGGATTGGTGGAACTTGCAGCTGTTCTATTTTATAGGGTAGTTACTAAAAACTCAGCTGCCGATTCCTGGATTTAA

Predicted protein sequences of Glyma04g35410

Limit To All Plant Sequences

>Glyma04g35410.2   sequence type=predicted peptide   gene model=Glyma04g35410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKVTSRDVQEIVEKLSSDKAKAREEGIKLLNTWLEGERSYNFCKFIGSNTAKLRPDEVPHSETWPFLISLLIKSASAEISSSKRRNPKMIYAKTLRIVVQRAEDAKCSGKMLPLSSVVKPLFNHVWDVLSNVPSFQSEYGIILRHLLSVRDYSFQMRKRIYCNLVFLYIEKVEASLNGKNISNCTSKEEVFRYILTLHSLLKYPPGDYPDNAREDIVKGFVRICSFIREEGKISRKLVECINTYLLNDGPNLGFQLFEIHNAMQQFVFRSWLTTHDRVLKDSLVFYARIQLNLISGAADRCLLVEQLLDVICKDLDQGSMSSTSMLRGDGNKDDKLGALSSSQCGLVELAAVLFYRVVTKNSAADSWI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain