SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g35256

Feature Type:gene_model
Chromosome:Gm04
Start:41593231
stop:41598565
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g35256
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G58610AT Annotation by Michelle Graham. TAIR10: ketol-acid reductoisomerase | chr3:21671561-21674639 FORWARD LENGTH=591 SoyBaseE_val: 2.00E-53ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006164GO-bp Annotation by Michelle Graham. GO Biological Process: purine nucleotide biosynthetic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009082GO-bp Annotation by Michelle Graham. GO Biological Process: branched-chain amino acid biosynthetic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004455GO-mf Annotation by Michelle Graham. GO Molecular Function: ketol-acid reductoisomerase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
PTHR21371Panther FAMILY NOT NAMED JGI ISS
PTHR21371:SF4Panther gb def: Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-a JGI ISS
PF01450PFAM Acetohydroxy acid isomeroreductase, catalytic domain JGI ISS
UniRef100_D2DKE6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Acetohydroxyacid isomeroreductase n=1 Tax=Glycine max RepID=D2DKE6_SOYBN SoyBaseE_val: 1.00E-56ISS
UniRef100_I1LSB5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LSB5_SOYBN SoyBaseE_val: 4.00E-58ISS

Expression Patterns of Glyma04g35256
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g35256 not represented in the dataset
Glyma04g35256 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g35256 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g181400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g35256
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g35256
>Glyma04g35256.1   sequence type=CDS   gene model=Glyma04g35256   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATACAGGAGTCACATCTTTCGGGAGAGAGGCATTTTACTTAGGGCTGTTCATGGTATTGTGGAATCCTTGTTTAGGAGGTACACTGAAAATGGAATGAGTGAAGATTTGGCCTATAACAACACTGTCGAGCCCATTACAAGAACTATATCTAAAATAATCTCGACTAAGGGTATGGAATTTGAGAAAGCATATAGTGCTTCATATTATTCCTGCATGGACATTTTGTATGCGTGCTATGAGGATATTGCTGCTAGAAGTGACATTCGCAGTGTTGTCTTGGATGGGCGGAACTTTTATGTATGTACGTTGCTTGCATTTCCCATGGGTAAAATTGATCAGACCCTGATGTGGAAGGTTGGTTAG
Predicted protein sequences of Glyma04g35256
>Glyma04g35256.1   sequence type=predicted peptide   gene model=Glyma04g35256   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEYRSHIFRERGILLRAVHGIVESLFRRYTENGMSEDLAYNNTVEPITRTISKIISTKGMEFEKAYSASYYSCMDILYACYEDIAARSDIRSVVLDGRNFYVCTLLAFPMGKIDQTLMWKVG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo