Glyma04g33950 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g33950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g33950): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g33950

Feature Type:	gene_model
Chromosome:	Gm04
Start:	39733809
stop:	39734426
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g33950

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G16390	AT	Annotation by Michelle Graham. TAIR10: organic cation/carnitine transporter 3 \| chr1:5602921-5604477 FORWARD LENGTH=518	SoyBase	E_val: 3.00E-68	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0055085	GO-bp	Annotation by Michelle Graham. GO Biological Process: transmembrane transport	SoyBase	N/A	ISS
GO:0070417	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to cold	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009705	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0005351	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0015144	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity	SoyBase	N/A	ISS
GO:0022857	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transmembrane transporter activity	SoyBase	N/A	ISS
PTHR24064	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24064:SF40	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00083	PFAM	Sugar (and other) transporter	JGI		ISS
UniRef100_I1JWX1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JWX1_SOYBN	SoyBase	E_val: 2.00E-145	ISS
UniRef100_Q9SA38	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Organic cation/carnitine transporter 3 n=1 Tax=Arabidopsis thaliana RepID=OCT3_ARATH	SoyBase	E_val: 1.00E-65	ISS

Expression Patterns of Glyma04g33950

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g33950 not represented in the dataset	Glyma04g33950 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g33950 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g171900	Wm82.a2.v1	IGC	As supplied by JGI
Glyma04g33941	Wm82.a1.v1.1	IGC	Correspondences based on a combination of genome sequence coordinate overlap (fjoin) and sequence similarity (ungapped blastn)

References for Glyma04g33950

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g33950

Limit To All Plant Sequences

>Glyma04g33950.1   sequence type=CDS   gene model=Glyma04g33950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGACTCCACCCCTCTCCTCTCCCAACCCAACCCATCATCATCATCGTCTCCCGACACACAAGAAGCACCGCCATCGAACCAACACCATCCCTCTCTGGGGTCCACAGTAGAACTCTGCATAGGCGAGTTCAACTGGTCCCAGTTCCTCCAGTCGATTCTGGTCTCCCTCGCATGGATATTCGACGCCCAGCAGACCTTCATCTCCGTCTTCACCGACGCCCTGCCCGAGTGGCACTGCACCGAGCGGGGCGCCAATGCATGCAAGACTGCCACCACAGTCTGCAGCCTCCCAAAGGGCTCGTGGGCCTGGGACGTGCCCACGCAGGCCTCCATCGTGTCGGAGTGGGGCCTGGAATGCGCCAACTCCGCGATCACGGGCCTCCCCGCTTCGATGTTCTTCTTGGGGTGTTTGATTGGCGGGTTCGTACTGGCCTCGCTAGCGGACTCGTCGCTCGGGCGCAAGAACATGCTCTTCTTCTCGTGCCTCGTGATGGCCATCACTTCCTTGCTCGTCACTCTCTCGCCCAACGTTTGGATCTATTCCGCTCTCAAGTTTCTCTGTGGGTTTGCTCGTGCTACCATTGGGACCTTCTGCGCTCGTGCTGGCCTCTGA

Predicted protein sequences of Glyma04g33950

Limit To All Plant Sequences

>Glyma04g33950.1   sequence type=predicted peptide   gene model=Glyma04g33950   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADSTPLLSQPNPSSSSSPDTQEAPPSNQHHPSLGSTVELCIGEFNWSQFLQSILVSLAWIFDAQQTFISVFTDALPEWHCTERGANACKTATTVCSLPKGSWAWDVPTQASIVSEWGLECANSAITGLPASMFFLGCLIGGFVLASLADSSLGRKNMLFFSCLVMAITSLLVTLSPNVWIYSALKFLCGFARATIGTFCARAGL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain