Glyma04g33840 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g33840): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g33840): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g33840

Feature Type:	gene_model
Chromosome:	Gm04
Start:	39620824
stop:	39622003
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g33840

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G27740	AT	Annotation by Michelle Graham. TAIR10: carbamoyl phosphate synthetase A \| chr3:10281470-10283792 REVERSE LENGTH=358	SoyBase	E_val: 6.00E-32	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0006164	GO-bp	Annotation by Michelle Graham. GO Biological Process: purine nucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0006543	GO-bp	Annotation by Michelle Graham. GO Biological Process: glutamine catabolic process	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0016036	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation	SoyBase	N/A	ISS
GO:0070409	GO-bp	Annotation by Michelle Graham. GO Biological Process: carbamoyl phosphate biosynthetic process	SoyBase	N/A	ISS
GO:0005951	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: carbamoyl-phosphate synthase complex	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0004088	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity	SoyBase	N/A	ISS
PTHR11405	Panther	CARBAMOYLTRANSFERASE RELATED	JGI		ISS
PTHR11405:SF4	Panther	CARBAMOYL-PHOSPHATE SYNTHASE, SMALL CHAIN-RELATED	JGI		ISS
PF00117	PFAM	Glutamine amidotransferase class-I	JGI		ISS
UniRef100_G7JAX1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Carbamoyl-phosphate synthase small chain n=1 Tax=Medicago truncatula RepID=G7JAX1_MEDTR	SoyBase	E_val: 8.00E-32	ISS
UniRef100_I1JWW2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JWW2_SOYBN	SoyBase	E_val: 8.00E-118	ISS

Expression Patterns of Glyma04g33840

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g33840 not represented in the dataset	Glyma04g33840 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g33840 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g171000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g33840

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g33840

Limit To All Plant Sequences

>Glyma04g33840.1   sequence type=CDS   gene model=Glyma04g33840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCATATACAACTAAGAACAATGCCAAATAACTTCATCAATATTATTATTTGCAAACATGTCTACAAAGGAATATTTTTATTCTTAAATGAAAGCAGTACAAGGATTTTCTGTATACTGCTAAACAACTTCCAACAGCCTTGCCATGACAGAAAAAGGCTACATGAGCTCATGTCCCTGTTGACCAAGATAGTCTGCTATTATTGCATGAAGTCAATGTCACTGAATTTGTTTTGGCATGAAGTAGAAGGCAACATAAACCACAACTATGCGGTTGACCCTGCCACACTGCCAGAAGGAGTGGAGGTTACTCATAGGAATCTTAATGATGGAAGTTGTGTTGGCCTCGCGTTCCCTGCTCAAAGAATAATGTCTCTTCAATACCACCCAGAGGCATCCCCAGGACCCCATGATTTTGATTACACTTTTAGGGAGCTTGTAGAATTAATGAAGCAAGAGAAAAAAGGGAAATCCTGTTGGAAATAA

Predicted protein sequences of Glyma04g33840

Limit To All Plant Sequences

>Glyma04g33840.1   sequence type=predicted peptide   gene model=Glyma04g33840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHIQLRTMPNNFINIIICKHVYKGIFLFLNESSTRIFCILLNNFQQPCHDRKRLHELMSLLTKIVCYYCMKSMSLNLFWHEVEGNINHNYAVDPATLPEGVEVTHRNLNDGSCVGLAFPAQRIMSLQYHPEASPGPHDFDYTFRELVELMKQEKKGKSCWK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain