|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT5G23090 | AT | Annotation by Michelle Graham. TAIR10: nuclear factor Y, subunit B13 | chr5:7749391-7750203 FORWARD LENGTH=159 | SoyBase | E_val: 5.00E-13 | ISS |
GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
GO:0005622 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: intracellular | SoyBase | N/A | ISS |
GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
GO:0003677 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: DNA binding | SoyBase | N/A | ISS |
GO:0003700 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity | SoyBase | N/A | ISS |
GO:0043565 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding | SoyBase | N/A | ISS |
PTHR11064 | Panther | TATA-BINDING PROTEIN-ASSOCIATED PHOSPHOPROTEIN | JGI | ISS | |
PTHR11064:SF8 | Panther | TATA-BINDING PROTEIN-ASSOCIATED PHOSPHOPROTEIN (DR1) | JGI | ISS | |
PF00808 | PFAM | Histone-like transcription factor (CBF/NF-Y) and archaeal histone | JGI | ISS | |
UniRef100_Q8W0W5 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Repressor protein n=2 Tax=Glycine max RepID=Q8W0W5_SOYBN | SoyBase | E_val: 2.00E-10 | ISS |
UniRef100_Q8W0W5 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Repressor protein n=2 Tax=Glycine max RepID=Q8W0W5_SOYBN | SoyBase | E_val: 2.00E-10 | ISS |
Glyma04g33820 not represented in the dataset |
Glyma04g33820 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma04g33820.1 sequence type=CDS gene model=Glyma04g33820 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCAAAAATTATTAAAGAGATGTTACCCCCGGATGTACGTGTTGCAAGAGATGCCCAAGATCTATTGATTGAGTGTTGTGTAGGTTAA
>Glyma04g33820.1 sequence type=predicted peptide gene model=Glyma04g33820 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSKIIKEMLPPDVRVARDAQDLLIECCVG*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||