Glyma04g33681 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g33681): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g33681): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g33681

Feature Type:	gene_model
Chromosome:	Gm04
Start:	39315732
stop:	39318560
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g33681

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G23190	AT	Annotation by Michelle Graham. TAIR10: cysteine-rich RLK (RECEPTOR-like protein kinase) 11 \| chr4:12141197-12143710 REVERSE LENGTH=667	SoyBase	E_val: 4.00E-65	ISS
GO:0006468	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein phosphorylation	SoyBase	N/A	ISS
GO:0006979	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to oxidative stress	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009816	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium, incompatible interaction	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0004672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein kinase activity	SoyBase	N/A	ISS
GO:0004674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016301	GO-mf	Annotation by Michelle Graham. GO Molecular Function: kinase activity	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
PTHR24420	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24420:SF430	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF07714	PFAM	Protein tyrosine kinase	JGI		ISS
UniRef100_C6ZRN5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cysteine-rich protein n=1 Tax=Glycine max RepID=C6ZRN5_SOYBN	SoyBase	E_val: 5.00E-96	ISS
UniRef100_C6ZRN5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Cysteine-rich protein n=1 Tax=Glycine max RepID=C6ZRN5_SOYBN	SoyBase	E_val: 5.00E-96	ISS

Expression Patterns of Glyma04g33681

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g33681 not represented in the dataset	Glyma04g33681 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g33681 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g170000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g33681

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g33681

Limit To All Plant Sequences

>Glyma04g33681.1   sequence type=CDS   gene model=Glyma04g33681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGTGTAGGAAGCAGTGGGATCTCAGCTGGAACAATTGTTCCAATTGTGGTTCCAATTACGATTGTTGTGCTTATATTTATAGTTAGAATTTGTTTCTTGAGTAGAAGAGCAAGGAAGAAGCAGCAGGATTCTGTAAAGGAAGGACAAAGCACTCTTCTGAGTGGACAAGTAGTAGCTATCAAGAGACTCTCCAAAAGCTCTGGACAAGGTGGAGAAGAATTTAAGAATGAAGTGCTGGTGGTTGCCAAGCTTCAACATAGAAATTTAGTCAGGCTTCTTGGGTTTTGCTTGCAAAGAGAAGAAAAACTACTTGTTTATGAATATGTGCCCAACAAAAGTCTTGACTATATTCTCTTTGATCCTGAAAAGCAAAGGGAGTTGGATTGGGGGAGACGTTACAAGATTATTGGAGGGATTGCTCGAGGTATTCAATACCTTCATGAAGATTCTAGGCTTAGAATTATACATCTTTATCTTAAAGCTAGTAACATATTGTTGGATGGAGATATGAATCCAAAAATCTCAAATTTGGCATGGCAAGAATATTTGGAGTCGACAAACTCAACAAAACACCAGCAGAATAGTAGGGACTTAGGCACAATTAATGGGCTTCAAAGTCGGGACTATATATGA

Predicted protein sequences of Glyma04g33681

Limit To All Plant Sequences

>Glyma04g33681.1   sequence type=predicted peptide   gene model=Glyma04g33681   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCVGSSGISAGTIVPIVVPITIVVLIFIVRICFLSRRARKKQQDSVKEGQSTLLSGQVVAIKRLSKSSGQGGEEFKNEVLVVAKLQHRNLVRLLGFCLQREEKLLVYEYVPNKSLDYILFDPEKQRELDWGRRYKIIGGIARGIQYLHEDSRLRIIHLYLKASNILLDGDMNPKISNLAWQEYLESTNSTKHQQNSRDLGTINGLQSRDYI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain