Glyma04g33250 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g33250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g33250): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g33250

Feature Type:	gene_model
Chromosome:	Gm04
Start:	38754202
stop:	38755029
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g33250

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G19320	AT	Annotation by Michelle Graham. TAIR10: RAN GTPase activating protein 2 \| chr5:6505310-6506947 REVERSE LENGTH=545	SoyBase	E_val: 3.00E-44	ISS
GO:0000085	GO-bp	Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle	SoyBase	N/A	ISS
GO:0006913	GO-bp	Annotation by Michelle Graham. GO Biological Process: nucleocytoplasmic transport	SoyBase	N/A	ISS
GO:0009407	GO-bp	Annotation by Michelle Graham. GO Biological Process: toxin catabolic process	SoyBase	N/A	ISS
GO:0009640	GO-bp	Annotation by Michelle Graham. GO Biological Process: photomorphogenesis	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0048527	GO-bp	Annotation by Michelle Graham. GO Biological Process: lateral root development	SoyBase	N/A	ISS
GO:0005635	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nuclear envelope	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
UniRef100_G7IE29	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ran GTPase-activating protein n=1 Tax=Medicago truncatula RepID=G7IE29_MEDTR	SoyBase	E_val: 7.00E-55	ISS
UniRef100_I1JWT1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1JWT1_SOYBN	SoyBase	E_val: 5.00E-87	ISS

Expression Patterns of Glyma04g33250

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g33250 not represented in the dataset	Glyma04g33250 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g33250 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g33250

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g33250

Limit To All Plant Sequences

>Glyma04g33250.3   sequence type=CDS   gene model=Glyma04g33250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCTGAATTCACAGCAGAGACCATTTTCAATCAAATTATGGCCTCCAAGTGAAAACACTAGGCAAACCCTTGTGGAGAGGATGACCAACAATTTGACTACTAAATCTCTTTTCACACAAAAGTATGGAACTTTGGACATGGAAGAGGCTGAAGAGAATGCAAAGAGGATTGAGGATGTGGCTTTTGCTACTGCAAATCTACACTATGAGAAAGAGCCAAATGGTGATGGAGGTTCTGCAGTCCAGCTTTATGCCAAGGAATGTAGTAAGCTCCTCCTAGATGTTCTTAAAAGAGGACCTAGTAAAAAGGATAATGAAGTGGTGACAAGCATAGAGGTGGAAATGGAACACATTGATATCGGTGAACCTGAGAATACTGGTATGCATCATATAGTTTGA

Predicted protein sequences of Glyma04g33250

Limit To All Plant Sequences

>Glyma04g33250.3   sequence type=predicted peptide   gene model=Glyma04g33250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MELNSQQRPFSIKLWPPSENTRQTLVERMTNNLTTKSLFTQKYGTLDMEEAEENAKRIEDVAFATANLHYEKEPNGDGGSAVQLYAKECSKLLLDVLKRGPSKKDNEVVTSIEVEMEHIDIGEPENTGMHHIV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain