SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g33095): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g33095): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g33095

Feature Type:gene_model
Chromosome:Gm04
Start:38572221
stop:38572975
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G26670AT Annotation by Michelle Graham. TAIR10: Vesicle transport v-SNARE family protein | chr1:9216103-9217793 FORWARD LENGTH=222 SoyBaseE_val: 5.00E-28ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0006869GO-bp Annotation by Michelle Graham. GO Biological Process: lipid transport SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0006891GO-bp Annotation by Michelle Graham. GO Biological Process: intra-Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0010351GO-bp Annotation by Michelle Graham. GO Biological Process: lithium ion transport SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0016197GO-bp Annotation by Michelle Graham. GO Biological Process: endosomal transport SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0046907GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular transport SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005768GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome SoyBaseN/AISS
GO:0005770GO-cc Annotation by Michelle Graham. GO Cellular Compartment: late endosome SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005802GO-cc Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0000149GO-mf Annotation by Michelle Graham. GO Molecular Function: SNARE binding SoyBaseN/AISS
GO:0005483GO-mf Annotation by Michelle Graham. GO Molecular Function: soluble NSF attachment protein activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
PTHR21230Panther VESICLE TRANSPORT V-SNARE PROTEIN VTI1-RELATED JGI ISS
PTHR21230:SF16Panther SUBFAMILY NOT NAMED JGI ISS
PF12352PFAM Snare region anchored in the vesicle membrane C-terminus JGI ISS
UniRef100_B9RLV4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Vesicle transport V-snare protein vti1a, putative n=1 Tax=Ricinus communis RepID=B9RLV4_RICCO SoyBaseE_val: 2.00E-33ISS
UniRef100_I1KCV5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KCV5_SOYBN SoyBaseE_val: 6.00E-44ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g33095 not represented in the dataset

Glyma04g33095 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma06g21130 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g166200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g33095.2   sequence type=transcript   gene model=Glyma04g33095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTGGACAGGCATCAAATGATCAAAAAGGAAGACTTCTGATTTCTACTGAAAGACTTAATCAATCCACTGACAGAATAAAGGAGAGCAGAAAAACAATGCTAGAGAAAGAGGATCTTGGTGAATTTATCCTCCGAGATTTGCATCAACAACGTGAATCCCTACTCCACGCCAATAAGACGGATCCATGGAGTGGATGATAACATTAGCAAGAGCAAGAAGATTTTGTCGGCCATGTCAAGAAGGATGAGCAGGAACAAAGGATTGTTGGCTCCTCAATGACAGCTCTGGTTCTTGCAATTATAATTATTTTATATTTCAAGCTGACTCATTAGCTTGCAATCTTTGCTTCTTAAATGGCTAGCTGTGTCTCAGATTGAAGTGTATGATGCCCAACAATGTGACGATGTTTGAAGAGTTGTGAGAACAATAGTTCTCATTTATTTATCTTATTACATGTAAAATTCTTTCATTTGAGCAAATGAGAATATTTTACCATTACAATGCATCATTGTTCAATTCATTCTATTATACTTTGC

>Glyma04g33095.1   sequence type=CDS   gene model=Glyma04g33095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTGGACAGGCATCAAATGATCAAAAAGGAAGACTTCTGATTTCTACTGAAAGACTTAATCAATCCACTGACAGAATAAAGGAGAGCAGAAAAACAATGCTAGAGAAAGAGGATCTTGGTGAATTTATCCTCCGAGATTTGCATCAACAACGTGAATCCCTACTCCACGCCAATAAGACGGGCATGGATGATAACATTAGCAAGAGCAAGAAGATTTTGTCGGCCATGTCAAGAAGGATGAGCAGGAACAAAGGATTGTTGGCTCCTCAATGA

>Glyma04g33095.2   sequence type=CDS   gene model=Glyma04g33095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTGGACAGGCATCAAATGATCAAAAAGGAAGACTTCTGATTTCTACTGAAAGACTTAATCAATCCACTGACAGAATAAAGGAGAGCAGAAAAACAATGCTAGAGAAAGAGGATCTTGGTGAATTTATCCTCCGAGATTTGCATCAACAACGTGAATCCCTACTCCACGCCAATAAGACGGATCCATGGAGTGGATGA

>Glyma04g33095.1   sequence type=predicted peptide   gene model=Glyma04g33095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLGQASNDQKGRLLISTERLNQSTDRIKESRKTMLEKEDLGEFILRDLHQQRESLLHANKTGMDDNISKSKKILSAMSRRMSRNKGLLAPQ*

>Glyma04g33095.2   sequence type=predicted peptide   gene model=Glyma04g33095   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLGQASNDQKGRLLISTERLNQSTDRIKESRKTMLEKEDLGEFILRDLHQQRESLLHANKTDPWSG*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo