Glyma04g32810 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g32810): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g32810): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g32810

Feature Type:	gene_model
Chromosome:	Gm04
Start:	37933922
stop:	37934839
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g32810

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G08490	AT	Annotation by Michelle Graham. TAIR10: chloroplastic NIFS-like cysteine desulfurase \| chr1:2685980-2688547 REVERSE LENGTH=463	SoyBase	E_val: 7.00E-51	ISS
GO:0000302	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to reactive oxygen species	SoyBase	N/A	ISS
GO:0001887	GO-bp	Annotation by Michelle Graham. GO Biological Process: selenium compound metabolic process	SoyBase	N/A	ISS
GO:0006534	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine metabolic process	SoyBase	N/A	ISS
GO:0006790	GO-bp	Annotation by Michelle Graham. GO Biological Process: sulfur compound metabolic process	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009073	GO-bp	Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process	SoyBase	N/A	ISS
GO:0010039	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to iron ion	SoyBase	N/A	ISS
GO:0010269	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to selenium ion	SoyBase	N/A	ISS
GO:0016226	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly	SoyBase	N/A	ISS
GO:0018283	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron incorporation into metallo-sulfur cluster	SoyBase	N/A	ISS
GO:0055072	GO-bp	Annotation by Michelle Graham. GO Biological Process: iron ion homeostasis	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0008483	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transaminase activity	SoyBase	N/A	ISS
GO:0009000	GO-mf	Annotation by Michelle Graham. GO Molecular Function: selenocysteine lyase activity	SoyBase	N/A	ISS
GO:0030170	GO-mf	Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding	SoyBase	N/A	ISS
GO:0031071	GO-mf	Annotation by Michelle Graham. GO Molecular Function: cysteine desulfurase activity	SoyBase	N/A	ISS
PTHR11601	Panther	CYSTEINE DESULFURYLASE	JGI		ISS
PTHR11601:SF13	Panther	NITROGEN FIXATION PROTEIN-RELATED	JGI		ISS
PF00266	PFAM	Aminotransferase class-V	JGI		ISS
UniRef100_G7JA74	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cysteine desulfurase n=1 Tax=Medicago truncatula RepID=G7JA74_MEDTR	SoyBase	E_val: 2.00E-55	ISS
UniRef100_UPI00023394BF	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI00023394BF related cluster n=1 Tax=unknown RepID=UPI00023394BF	SoyBase	E_val: 3.00E-75	ISS

Expression Patterns of Glyma04g32810

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g32810 not represented in the dataset	Glyma04g32810 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g32810 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g32810

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g32810

Limit To All Plant Sequences

>Glyma04g32810.1   sequence type=CDS   gene model=Glyma04g32810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GAAGTAAATGGCTCAAAACTTGTTTACTTAGACAATGTAGCAACTTGTCAATACACATACAATTTATATCTATTATTACTTAAACAGCCAAATGCTTTATTAAGGAAAGTTGCTTCTTTTATAAATGCCACTTATTCCAAAGAGATTATATTCACAAAAAGTGCTTCTGAAGCTATCAATCTTGTTGCCTATTCTTGGGGGTTGTCAAATTTAAAAGTAGATGATGAGATGATACTTACAGTTGTTGAACATCACAGTGCGATTGTTCCTTGGCAAATAGTAGCTCAAAAAATAGGGGTTGTTTTGAATTTTGTGGATTTAAACCAAGATGAAATTCCAAATATAGAAAAATTGAAAGAAATGCTCTCAAGGAAGACCAAAATAGTTGTTTTCCATCATGTTTCAAATGTGCTT

Predicted protein sequences of Glyma04g32810

Limit To All Plant Sequences

>Glyma04g32810.1   sequence type=predicted peptide   gene model=Glyma04g32810   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
EVNGSKLVYLDNVATCQYTYNLYLLLLKQPNALLRKVASFINATYSKEIIFTKSASEAINLVAYSWGLSNLKVDDEMILTVVEHHSAIVPWQIVAQKIGVVLNFVDLNQDEIPNIEKLKEMLSRKTKIVVFHHVSNVL

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain