Glyma04g31751 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g31751

Feature Type:	gene_model
Chromosome:	Gm04
Start:	35981413
stop:	35987604
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g31751

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G08120	AT	Annotation by Michelle Graham. TAIR10: movement protein binding protein 2C \| chr5:2600743-2602678 REVERSE LENGTH=326	SoyBase	E_val: 4.00E-62	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0010375	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal complex patterning	SoyBase	N/A	ISS
GO:0010497	GO-bp	Annotation by Michelle Graham. GO Biological Process: plasmodesmata-mediated intercellular transport	SoyBase	N/A	ISS
GO:0043622	GO-bp	Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization	SoyBase	N/A	ISS
GO:0051607	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to virus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0015630	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: microtubule cytoskeleton	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
UniRef100_I1MT94	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MT94_SOYBN	SoyBase	E_val: 5.00E-102	ISS
UniRef100_Q9LEZ4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Movement protein binding protein 2C n=2 Tax=Arabidopsis thaliana RepID=Q9LEZ4_ARATH	SoyBase	E_val: 2.00E-59	ISS

Expression Patterns of Glyma04g31751

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g31751 not represented in the dataset	Glyma04g31751 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g31751 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g159100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g31751

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g31751

Limit To All Plant Sequences

>Glyma04g31751.1   sequence type=CDS   gene model=Glyma04g31751   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCACGAGAGGCAGCGTTTGGTGGATTCGGAAGAAAAACGTGATTTGTACGACCCGAATTCTCCGCTTTCTGAGAGAGACGCCGATTTAGATCGCGTCCTCTTCAATAACCTCGTCCAGATTGTCCCTCTCGTGCAGTCCTTCATCGATGGTGAAGGAAGAAGTTCATTCACGCGTCAGGGTTCCATGGTGTACACAAAGAGGCCTTCAAGAAAGTCTCGGTTGAAAAGAAGGTTTGACACGAGAAAAGGACAGAAAGATGAGTCTGTCATATTGAAGGAGCAGGTGGAGGAGCTGCAAATGAAAATATTGGAGAAAGATGAACTTATAGAGTCATCAGAAAACACAAAAAAACAGATGAAAGCCCTTGAACAAAAACTTTATGAACTGAAACACCATGCTTCGGAAAAGGATTCTTTGCTTAAGTCTACAAAACGACAACTCTTTGATGTGAAGTTTGAGCTTGCAGACAAACAAGCTGCTCTTGAAAAGATACATTGGGAAGCAATGACATCCAACAAGAAAGTGGAGAAATTGCAAGAAGAGCTAGATTCCATGCAAGGAGATATTTCATCATTTACATTGCTGCTTAATCGCTTGACAATATCTGACACCGCTGAGTACACTGATGATTATGATATTAAGCCATATGAGTTCAATCACCTGCGTAGTATAGATGATTGGGACGAGATGGAAATGCAGAAAATGGAAGAAGCAAGAAAAACATATATCGCTGCCGTTGTTGCTGGAAAGGAAAAACAAGATGAAGAATCTATGGCTACTGTTGTCAATTCTAGGTTACAACTTGAGTCAATTCTTTTCAAACCAACATAA

Predicted protein sequences of Glyma04g31751

Limit To All Plant Sequences

>Glyma04g31751.1   sequence type=predicted peptide   gene model=Glyma04g31751   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MHERQRLVDSEEKRDLYDPNSPLSERDADLDRVLFNNLVQIVPLVQSFIDGEGRSSFTRQGSMVYTKRPSRKSRLKRRFDTRKGQKDESVILKEQVEELQMKILEKDELIESSENTKKQMKALEQKLYELKHHASEKDSLLKSTKRQLFDVKFELADKQAALEKIHWEAMTSNKKVEKLQEELDSMQGDISSFTLLLNRLTISDTAEYTDDYDIKPYEFNHLRSIDDWDEMEMQKMEEARKTYIAAVVAGKEKQDEESMATVVNSRLQLESILFKPT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain