SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g31211

Feature Type:gene_model
Chromosome:Gm04
Start:35435998
stop:35436521
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g31211
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G60830AT Annotation by Michelle Graham. TAIR10: basic leucine-zipper 70 | chr5:24472639-24473319 FORWARD LENGTH=206 SoyBaseE_val: 2.00E-14ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
PF07716PFAM Basic region leucine zipper JGI ISS
UniRef100_B9RLH1UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA binding protein, putative n=1 Tax=Ricinus communis RepID=B9RLH1_RICCO SoyBaseE_val: 8.00E-17ISS
UniRef100_I1K164UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1K164_SOYBN SoyBaseE_val: 1.00E-24ISS

Expression Patterns of Glyma04g31211
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g31211 not represented in the dataset
Glyma04g31211 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g31211 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g158300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g31211
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g31211
>Glyma04g31211.1   sequence type=CDS   gene model=Glyma04g31211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGGCAATGATGCTAACAGGCTCCATGGACCACCAAATTATGCTACCTTAACACCGCAACATTGTACCCAGAATTTCACTCTGAACAATGAAACAATTGAAGGCCACCAGAGACACCGTGACCGCATTTTGACCCATGTGGATTCATCTCAAGTGTTTAACTCTATTTTTCCTTTATACTACTCCAAATTGCACCTTTCCAACAACACTAACAGTCCAAACACCTCATCAAACAGCAACAACAACAACACCAATGCTGACGAAGCAAATGCTCTCCTCGAAGACCGAACGCAGAAGAGGATGTTCTTCAACAGAGAATCTGCTCGTAGGTCCCGAATGCAGAGAAAGCAACAAATTGAGACCCCCTTCAGTACTTTGGATCGCCAACTCTCCGAAAAGATCATTTACTTGCTGGAATGCAACCAACAAATCCTCGAACACAATGCACAACTCAAAGACAATGTTTCTTCTCTTCAAGTTAATTTCACTCTGATTTGTTAG
Predicted protein sequences of Glyma04g31211
>Glyma04g31211.1   sequence type=predicted peptide   gene model=Glyma04g31211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEGNDANRLHGPPNYATLTPQHCTQNFTLNNETIEGHQRHRDRILTHVDSSQVFNSIFPLYYSKLHLSNNTNSPNTSSNSNNNNTNADEANALLEDRTQKRMFFNRESARRSRMQRKQQIETPFSTLDRQLSEKIIYLLECNQQILEHNAQLKDNVSSLQVNFTLIC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo