Report for Sequence Feature Glyma04g23120
Feature Type: gene_model
Chromosome: Gm04
Start: 26457840
stop: 26458553
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma04g23120
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G62690 AT
Annotation by Michelle Graham. TAIR10: AtL5 | chr3:23185829-23186602 REVERSE LENGTH=257
SoyBase E_val: 7.00E-10 ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
PF00097 PFAM
Zinc finger, C3HC4 type (RING finger)
JGI ISS
UniRef100_G7KB55 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: E3 ubiquitin-protein ligase n=1 Tax=Medicago truncatula RepID=G7KB55_MEDTR
SoyBase E_val: 2.00E-18 ISS
UniRef100_I1JWB2 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JWB2_SOYBN
SoyBase E_val: 5.00E-107 ISS
Expression Patterns of Glyma04g23120
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma04g23120 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.04g153500 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma04g23120
Coding sequences of Glyma04g23120
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma04g23120.1 sequence type=CDS gene model=Glyma04g23120 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAGCCCTCTAATCAGATTCGCCTTAGCAATTAACCTTATTTCCTCTTCCCATACCTTCAGAATGTTCATGAAGTGCTTAGCTCTCCCTCACACCCTTCTAAAATGGACATTACATTCCATTTTCCACCATTTGTGGTATCCCTTATCTTGCACCCTCTTTCGAGAAAAGCTTAGCTCTTGCCATGATCACGTGCCCACCTATGTGTCACGGGAAGATGAAGATTGCGCCGTGTGTCTCTGCAAAATGGGAGAAACAGAAGAAAGGATCATAACGCTGCGGTGTGGACATGTCTTCCACAGAGATTGCTTGAATACTTGGGTTGGTTTCAACAATGCCACTACTTGCCCTCTTTGCAGAGATTCATCGGGAAAAAGGGAATCTGGAAAGTTATTTAGAGCTGAAATTCTGCTATTAGATTCTTGTTCCATCAAAAGATTCAGTTTAGAAAACAACTAG
Predicted protein sequences of Glyma04g23120
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma04g23120.1 sequence type=predicted peptide gene model=Glyma04g23120 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSPLIRFALAINLISSSHTFRMFMKCLALPHTLLKWTLHSIFHHLWYPLSCTLFREKLSSCHDHVPTYVSREDEDCAVCLCKMGETEERIITLRCGHVFHRDCLNTWVGFNNATTCPLCRDSSGKRESGKLFRAEILLLDSCSIKRFSLENN*