SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma04g23120

Feature Type:gene_model
Chromosome:Gm04
Start:26457840
stop:26458553
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G62690AT Annotation by Michelle Graham. TAIR10: AtL5 | chr3:23185829-23186602 REVERSE LENGTH=257 SoyBaseE_val: 7.00E-10ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
UniRef100_G7KB55UniRef Annotation by Michelle Graham. Most informative UniRef hit: E3 ubiquitin-protein ligase n=1 Tax=Medicago truncatula RepID=G7KB55_MEDTR SoyBaseE_val: 2.00E-18ISS
UniRef100_I1JWB2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JWB2_SOYBN SoyBaseE_val: 5.00E-107ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g153500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g23120.1   sequence type=CDS   gene model=Glyma04g23120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCCCTCTAATCAGATTCGCCTTAGCAATTAACCTTATTTCCTCTTCCCATACCTTCAGAATGTTCATGAAGTGCTTAGCTCTCCCTCACACCCTTCTAAAATGGACATTACATTCCATTTTCCACCATTTGTGGTATCCCTTATCTTGCACCCTCTTTCGAGAAAAGCTTAGCTCTTGCCATGATCACGTGCCCACCTATGTGTCACGGGAAGATGAAGATTGCGCCGTGTGTCTCTGCAAAATGGGAGAAACAGAAGAAAGGATCATAACGCTGCGGTGTGGACATGTCTTCCACAGAGATTGCTTGAATACTTGGGTTGGTTTCAACAATGCCACTACTTGCCCTCTTTGCAGAGATTCATCGGGAAAAAGGGAATCTGGAAAGTTATTTAGAGCTGAAATTCTGCTATTAGATTCTTGTTCCATCAAAAGATTCAGTTTAGAAAACAACTAG

>Glyma04g23120.1   sequence type=predicted peptide   gene model=Glyma04g23120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSPLIRFALAINLISSSHTFRMFMKCLALPHTLLKWTLHSIFHHLWYPLSCTLFREKLSSCHDHVPTYVSREDEDCAVCLCKMGETEERIITLRCGHVFHRDCLNTWVGFNNATTCPLCRDSSGKRESGKLFRAEILLLDSCSIKRFSLENN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo