SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma04g21376

Feature Type:gene_model
Chromosome:Gm04
Start:24400517
stop:24403762
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G21250AT Annotation by Michelle Graham. TAIR10: multidrug resistance-associated protein 6 | chr3:7457668-7463261 REVERSE LENGTH=1453 SoyBaseE_val: 5.00E-134ISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0000325GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0042626GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances SoyBaseN/AISS
PTHR24223Panther FAMILY NOT NAMED JGI ISS
PTHR24223:SF203Panther JGI ISS
PF00005PFAM ABC transporter JGI ISS
UniRef100_G8A2S0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Multidrug resistance protein ABC transporter family (Fragment) n=1 Tax=Medicago truncatula RepID=G8A2S0_MEDTR SoyBaseE_val: 8.00E-155ISS
UniRef100_I1KUW0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KUW0_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g21376 not represented in the dataset

Glyma04g21376 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g21376.1   sequence type=CDS   gene model=Glyma04g21376   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGTTTTTCCAAAGCTACTTGGACTACAAGGCTCAAAACGCACAAGTGACTAATGCTCTCGGAAGCCGAAACGTCGTGCACACTCCAGACATCTTCTCAAAGATCCCAACGGTCAGATCATGGACAAAGATCTGTTTTGAACTTCTTGATATCCCTTTTACCACCATCTTTGTAATATCTGAAATAGATGAACTTCTGACAATGATTGGGATAATGGTTTCGGTCACATGGGAAGTGCTCATTGTTGCAGTTCTTGCCATATTGGCCTCAAAATATGTTCAGGGCTATTATCAAGCCTCTACTAAAGAAATTATACAGATCAATGGAACTACTAAAGCTCCATTTATGAATTTTAGAGTTGAGACATCACTTGGTGTAGTTACTATCAAAACTTTCAACATGGCTGATAGATTTTTCAAAAACTACCTTAATCTTGTTAACACAAATGCCACAATGTTCTTTCATTCCAATGCTGCTATCAAATGGTTAATTCTGATGATTGGATTACTTCAAAATTTGACACTCTTCACTGTAGCTTTGCTGCTTGTTCTACTTCCAAAAAGGATATGCCTTATAGGACTTTTTTTGTCTCATGCTTTTTCATTGACATTAACTGTAGTTTATCTGACTCAAATGTTTTGTAACTTATTAAACTATCCTAGTGCAATTGTAAAGGATAATAGACCACCACCTTCTTGGCCTTCCAAGGGTAGAATAGATCTCCAATCTCTAGAGATTAGATATCAGCCAAATGCTCCATTAGTTCTTAAGGGCATCTCTTATAGGTTTAAAGAAGGGAGTAGAGTGGGAAGGACTGGAAGTGGAAAAACTACACTTATAAGTGCTTTGTTTTGCTTAGTTGAGCCTACCAGAGGTGACATTCTTATTGATGGTATTAATATCTGCTCAATAGGGCTAAAAGATTTGAGAACAAAGCTAAGCATCATTCCTCAAGAACCAACTCTTTTCAAGGGCAACATTCAAAAGAACTTGGACCCTCTATGCTTGTACTCTAATAATGAAATATGGAAGGCTTTAGAGAAATGTCAGCTTAAGGCAACAATTAGTAGTCTATCAAATCTCTTGGACAGTTCTGGTAGTGTGGCACAACGTCAACTCAAATGTCTCGGAAGATTGCTTCTTAAGAGGAACAAAATTATTGTAATAGAC

>Glyma04g21376.1   sequence type=predicted peptide   gene model=Glyma04g21376   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTFFQSYLDYKAQNAQVTNALGSRNVVHTPDIFSKIPTVRSWTKICFELLDIPFTTIFVISEIDELLTMIGIMVSVTWEVLIVAVLAILASKYVQGYYQASTKEIIQINGTTKAPFMNFRVETSLGVVTIKTFNMADRFFKNYLNLVNTNATMFFHSNAAIKWLILMIGLLQNLTLFTVALLLVLLPKRICLIGLFLSHAFSLTLTVVYLTQMFCNLLNYPSAIVKDNRPPPSWPSKGRIDLQSLEIRYQPNAPLVLKGISYRFKEGSRVGRTGSGKTTLISALFCLVEPTRGDILIDGINICSIGLKDLRTKLSIIPQEPTLFKGNIQKNLDPLCLYSNNEIWKALEKCQLKATISSLSNLLDSSGSVAQRQLKCLGRLLLKRNKIIVID







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo