SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g17070): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g17070): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g17070

Feature Type:gene_model
Chromosome:Gm04
Start:18494920
stop:18498925
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g17070
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12600AT Annotation by Michelle Graham. TAIR10: nudix hydrolase homolog 16 | chr3:4004676-4005995 FORWARD LENGTH=171 SoyBaseE_val: 5.00E-61ISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
KOG2839 KOG Diadenosine and diphosphoinositol polyphosphate phosphohydrolase JGI ISS
PTHR12629Panther DIPHOSPHOINOSITOL POLYPHOSPHATE PHOSPHOHYDROLASE JGI ISS
PF00293PFAM NUDIX domain JGI ISS
UniRef100_G7LGT1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nudix hydrolase n=1 Tax=Medicago truncatula RepID=G7LGT1_MEDTR SoyBaseE_val: 6.00E-77ISS
UniRef100_UPI000233C844UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C844 related cluster n=1 Tax=unknown RepID=UPI000233C844 SoyBaseE_val: 1.00E-100ISS

Expression Patterns of Glyma04g17070
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g17070 not represented in the dataset
Glyma04g17070 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g17070 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g135000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g17070
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g17070
>Glyma04g17070.2   sequence type=CDS   gene model=Glyma04g17070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TGTGTTCCATTTAGGTATAAAGATGACTGTGGAGACTCTTGTTCCGAGAAGATTGTTGAAGTGCTTATGATTAATTCGACTAGTGGACCAGGTCTTTTGTTTCCAAAGGGAGGTTGGGAGAATGATGAAACTGTTGAGGAGGCTGCAGTTAGAGAAGCTATTGAAGAAGCAGGAGTTCGAGGAGACCTAATGGATTTTCTTGGGTACTATGAATTTAGGAGTAAGACCCTCCAAGATGAGTGTAGTCCAGAAGGTTTATGCAAAGCAGCAATGTTTGCATTGTTTGTGAAAGAGGAACTTGAGTCATGGCCTGAGCAAAGCACCAGAAAAAGGAGTTGGGTGGCTGTATCAGAGGCACTAGCAAACTGTCGACATGCATGGATGAGGGATGCCCTGCATTGTTTCTGTAAATGGCATGAGGAGTGCAAGGGAGGATCAAGCCTGAACTGA
Predicted protein sequences of Glyma04g17070
>Glyma04g17070.2   sequence type=predicted peptide   gene model=Glyma04g17070   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CVPFRYKDDCGDSCSEKIVEVLMINSTSGPGLLFPKGGWENDETVEEAAVREAIEEAGVRGDLMDFLGYYEFRSKTLQDECSPEGLCKAAMFALFVKEELESWPEQSTRKRSWVAVSEALANCRHAWMRDALHCFCKWHEECKGGSSLN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo