SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g16300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g16300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g16300

Feature Type:gene_model
Chromosome:Gm04
Start:17402439
stop:17403181
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g16300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G21660AT Annotation by Michelle Graham. TAIR10: proline-rich spliceosome-associated (PSP) family protein | chr4:11506259-11509772 REVERSE LENGTH=584 SoyBaseE_val: 6.00E-50ISS
GO:0006397GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA processing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
PTHR12785Panther FAMILY NOT NAMED JGI ISS
PTHR12785:SF3Panther CUS1 JGI ISS
UniRef100_B9RZ56UniRef Annotation by Michelle Graham. Most informative UniRef hit: Splicing factor 3B subunit, putative n=1 Tax=Ricinus communis RepID=B9RZ56_RICCO SoyBaseE_val: 1.00E-49ISS
UniRef100_UPI000233A833UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233A833 related cluster n=1 Tax=unknown RepID=UPI000233A833 SoyBaseE_val: 2.00E-69ISS

Expression Patterns of Glyma04g16300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g16300 not represented in the dataset
Glyma04g16300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g16300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma04g16300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g16300
>Glyma04g16300.1   sequence type=CDS   gene model=Glyma04g16300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTTCCTAGCACTCCCACTAGAGTGGAGACACTTGATGTTATTGACCTTCGTAAGCAGCAGAGGAAGGAACCTAAAAAGCCTCTTTATCAAGTACTTGAAGAGAAGAAGGAAAAAATTGCTCCAGGAACTTTGCTTGGAACTACACACACTTATGTGGTTAACACTGGCACCCAGGACAAGTCAGGGGCTAAAAGGATTGATTTACTTAGAGGACAAAAGTCACATAAAGTAGATGTCACTTTACTGCCACAAGAGTTGGATGCCATGGAAAATGTTTTACCCGCGAAAAACGTTCTTTTGCCTGTTAGTGATTATGAAGAAGCAAGGGAGGAAAAGAAGTTACGAAATCAGTGTGAGGATTCCAGTGACATG
Predicted protein sequences of Glyma04g16300
>Glyma04g16300.1   sequence type=predicted peptide   gene model=Glyma04g16300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LPSTPTRVETLDVIDLRKQQRKEPKKPLYQVLEEKKEKIAPGTLLGTTHTYVVNTGTQDKSGAKRIDLLRGQKSHKVDVTLLPQELDAMENVLPAKNVLLPVSDYEEAREEKKLRNQCEDSSDM






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo