Glyma04g15850 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g15850

Feature Type:	gene_model
Chromosome:	Gm04
Start:	16673920
stop:	16674985
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g15850

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G14700	AT	Annotation by Michelle Graham. TAIR10: purple acid phosphatase 3 \| chr1:5058680-5060988 FORWARD LENGTH=366	SoyBase	E_val: 3.00E-81	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0003993	GO-mf	Annotation by Michelle Graham. GO Molecular Function: acid phosphatase activity	SoyBase	N/A	ISS
GO:0004722	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
PTHR10161	Panther	ACID PHOSPHATASE-RELATED	JGI		ISS
PF00149	PFAM	Calcineurin-like phosphoesterase	JGI		ISS
UniRef100_G7LE88	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Purple acid phosphatase n=1 Tax=Medicago truncatula RepID=G7LE88_MEDTR	SoyBase	E_val: 2.00E-100	ISS
UniRef100_I1K597	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K597_SOYBN	SoyBase	E_val: 2.00E-128	ISS

Expression Patterns of Glyma04g15850

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g15850 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g128300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g15850

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g15850

Limit To All Plant Sequences

>Glyma04g15850.2   sequence type=CDS   gene model=Glyma04g15850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAAAGCTGGAGCTCTTTAGACACTCATCTCTTTGTGTATGTCAGATGGGAAGGGTTGCTACAAAGTTAAATATCGACTTTGTGATATCCACTAGAGACAATTTCTACGATGATGGATTGACTGGTATAGATGACCCTGCATTTGAAATTTCGTTCTCAAAAATCTACACTGCCAAGAGCCTCCAAAAGCAATGGTATAGTGTGTTGGGCAACCATGACTACAGGGGTGATGTTGAAGCTCAATTGAATCCAATCCTTCAGAAAATTGATCCTAGATGGATCTGCCAAAGATCATTTATTGTTGATACTGAAATTGCTGAGTTCTTCTTCATTGATTCAACACCTTTTGTGGACAAGTATTTTCTTAAGCCAAAGGACCACAAGTATGACTCGAGAGGAGTGCTTCCAAGGGAAAAATATTTATCAAAGCTCTTGAAGGATCTGGAAATAGCATTGAAGGATTCTACTGCCAAGTGGAAGATTGTTGTGGGGCATCATCCTGTAAGAAGCATAGGACATCACGGTGACACCAAAGAGCTCATAAGATAG

Predicted protein sequences of Glyma04g15850

Limit To All Plant Sequences

>Glyma04g15850.2   sequence type=predicted peptide   gene model=Glyma04g15850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQKLELFRHSSLCVCQMGRVATKLNIDFVISTRDNFYDDGLTGIDDPAFEISFSKIYTAKSLQKQWYSVLGNHDYRGDVEAQLNPILQKIDPRWICQRSFIVDTEIAEFFFIDSTPFVDKYFLKPKDHKYDSRGVLPREKYLSKLLKDLEIALKDSTAKWKIVVGHHPVRSIGHHGDTKELIR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain