SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g15392

Feature Type:gene_model
Chromosome:Gm04
Start:16017431
stop:16019373
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g15392
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G11160AT Annotation by Michelle Graham. TAIR10: Translation initiation factor 2, small GTP-binding protein | chr4:6803846-6806726 FORWARD LENGTH=743 SoyBaseE_val: 3.00E-21ISS
GO:0006413GO-bp Annotation by Michelle Graham. GO Biological Process: translational initiation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016926GO-bp Annotation by Michelle Graham. GO Biological Process: protein desumoylation SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0050665GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0003743GO-mf Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
UniRef100_G7JWF0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Translation initiation factor IF-2 n=1 Tax=Medicago truncatula RepID=G7JWF0_MEDTR SoyBaseE_val: 3.00E-24ISS
UniRef100_UPI0002339ECCUniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339ECC related cluster n=1 Tax=unknown RepID=UPI0002339ECC SoyBaseE_val: 5.00E-25ISS

Expression Patterns of Glyma04g15392
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g15392 not represented in the dataset
Glyma04g15392 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g15392 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma04g15392
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Transcripts of Glyma04g15392
>Glyma04g15392.2   sequence type=transcript   gene model=Glyma04g15392   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTAATATATTAACTAATCAATAACTTGCATTTATTTTATTGAGAAAAATAATAATAAATAATAGGAGAAAACTGATAACATTGTACATCCTTGATAAAATAAAATGGGTCCAGTAGTCCGTGTAGGTCCAACTAGTTAGTAGTATTTAGGCCTAGCATGGACTTAATCATATTTTTTACAATTAGAAAAAAGAATCAGTGAGTACCCATATGCTTCTTAATCCCCTCCCTACCCATGTTCACGTTAAAATGTACTTATATTTTAGTTTTAAAATATTTTTTTACATATATTTAGATCCAGAAAATTAGTCATCATTGGATTCTCAAATCAAAAATCAATTCTCAACTTCAGTTAAGAGATTCAAATTCGAAATTAATTACTTGTTTAAAAAATTTTAGTTTATATGATTTTTTATATACTAGTACCACGGTAGCATTAAATTTGTAGGATATTATAATAACCAAACAAATGATTATTACTCATAATTTATACATACTAGCTAGTAAGTTACTTAAGCACATTTATTTAGACTTCGAGAAAGATAAAAATAGTAAGTGTGGATTGATTAATTAATGGGGTTTCCACCTTGGCTTTAGTGTAGAGACAGACTATGCTCACGTTGTTCAATAATGGCTTTAGTGTAGAGGCTTTGATGGAATTATTAAAGTCTGGGATGTATCTAGCAAAAATTGGACTGGATAACCTAGAAGAAGCTTTACTACTTCAGGCTGATATGATGGATCTTAAAGCACGAATTCATGGGCCTGCTCAAGCATATGTGATGGAAGCGAGACTTGACGAAGGACGGGGTCCATTAGTAACTACTATAGTGAAGGCAGGGACTCTTTTCAATTTGTTGTTTTAAAATTTTGGTTTAAAATAGTGGAAGTGGTCCAAGGTGATGCTAGGAACGTGTTGTGCATTTGTATTGGTTTTGGGAAGCCAAGGCTACAGAGTTATCAAAAGGTACCTATTAATTAACTATACATTACTTTAATACTATACTTTGATATGAAATTTTGACTTTGATATGAAATT
Coding sequences of Glyma04g15392
>Glyma04g15392.1   sequence type=CDS   gene model=Glyma04g15392   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTCACGTTGTTCAATAATGGCTTTAGTGTAGAGGCTTTGATGGAATTATTAAAGTCTGGGATGTATCTAGCAAAAATTGGACTGGATAACCTAGAAGAAGCTTTACTACTTCAGGCTGATATGATGGATCTTAAAGCACGAATTCATGGGCCTGCTCAAGCATATGTGATGGAAGCGAGACTTGACGAAGGACGGGGTCCATTAGTAACTACTATAGTGAAGGCAGGGACTCTTTTCAATTTGTTGTTTTAA

>Glyma04g15392.2   sequence type=CDS   gene model=Glyma04g15392   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTCACGTTGTTCAATAATGGCTTTAGTGTAGAGGCTTTGATGGAATTATTAAAGTCTGGGATGTATCTAGCAAAAATTGGACTGGATAACCTAGAAGAAGCTTTACTACTTCAGGCTGATATGATGGATCTTAAAGCACGAATTCATGGGCCTGCTCAAGCATATGTGATGGAAGCGAGACTTGACGAAGGACGGGGTCCATTAGTAACTACTATAGTGAAGGCAGGGACTCTTTTCAATTTGTTGTTTTAA
Predicted protein sequences of Glyma04g15392
>Glyma04g15392.1   sequence type=predicted peptide   gene model=Glyma04g15392   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLTLFNNGFSVEALMELLKSGMYLAKIGLDNLEEALLLQADMMDLKARIHGPAQAYVMEARLDEGRGPLVTTIVKAGTLFNLLF*

>Glyma04g15392.2   sequence type=predicted peptide   gene model=Glyma04g15392   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLTLFNNGFSVEALMELLKSGMYLAKIGLDNLEEALLLQADMMDLKARIHGPAQAYVMEARLDEGRGPLVTTIVKAGTLFNLLF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo