Glyma04g15200 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma04g15200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma04g15200): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma04g15200

Feature Type:	gene_model
Chromosome:	Gm04
Start:	15764870
stop:	15765695
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g15200

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G04780	AT	Annotation by Michelle Graham. TAIR10: FASCICLIN-like arabinoogalactan 7 \| chr2:1677488-1678252 FORWARD LENGTH=254	SoyBase	E_val: 2.00E-36	ISS
GO:0006084	GO-bp	Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process	SoyBase	N/A	ISS
GO:0009664	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization	SoyBase	N/A	ISS
GO:0009832	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis	SoyBase	N/A	ISS
GO:0010075	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth	SoyBase	N/A	ISS
GO:0016126	GO-bp	Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process	SoyBase	N/A	ISS
GO:0016132	GO-bp	Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0031225	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane	SoyBase	N/A	ISS
GO:0046658	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane	SoyBase	N/A	ISS
PTHR10900	Panther	TRANSFORMING GROWTH FACTOR	JGI		ISS
PTHR10900:SF23	Panther	FLA (FASCICLIN-LIKE ARABINOGALACTAN PROTEIN)	JGI		ISS
PF02469	PFAM	Fasciclin domain	JGI		ISS
UniRef100_I1JVX4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JVX4_SOYBN	SoyBase	E_val: 4.00E-128	ISS
UniRef100_Q1W7H2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cell adhesion protein (Fragment) n=1 Tax=Solanum lycopersicum RepID=Q1W7H2_SOLLC	SoyBase	E_val: 3.00E-38	ISS

Expression Patterns of Glyma04g15200

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g15200 not represented in the dataset	Glyma04g15200 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g15200 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g15200

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g15200

Limit To All Plant Sequences

>Glyma04g15200.1   sequence type=CDS   gene model=Glyma04g15200   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGTTTTCTATGATTTTCATTGTTAGCAACATTATGCTACTTTTTAGTTCATCATTTGGAAAAATTGCTAGTCATCCCTTTCTGAGCCCAACTCCAGCACTAGCCCCGACACTAGACTTCCTGAACCTCACTGAGTTACTCAGTGTTGTTGGTCCATTTCACACCTTCCTTGGATACCTTGAGTCCACTAAAGTGATTGACACTTTCCAAAACCAAGCCAACAACACTGAAGAGGGAATTACCATCTTTGTTCCTAAGGACAACGACTTCAATGCTATAAAGAAAACTACCCTATCCAACCTCACTTCTAACCGGCTAAAGCAAGTGATCCTCTTCCATGCCTTGCCACATTTCTATTCTGATGTCAATGTGAAGAAAGAAGAAGAAATAAAGGACACAAACAATTCAAGCTCTGAAGGGACAATAGAGAATCCAACAACCAGCGAAGATGTGAAAGACAACAAGAGATTAAGGGCAATTGGAGTTAATACAGTAGGGCTTCAAAGAATGGGCCTTAAAGAAAATGCTTTATTTGACTCTCTGGCT

Predicted protein sequences of Glyma04g15200

Limit To All Plant Sequences

>Glyma04g15200.1   sequence type=predicted peptide   gene model=Glyma04g15200   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEFSMIFIVSNIMLLFSSSFGKIASHPFLSPTPALAPTLDFLNLTELLSVVGPFHTFLGYLESTKVIDTFQNQANNTEEGITIFVPKDNDFNAIKKTTLSNLTSNRLKQVILFHALPHFYSDVNVKKEEEIKDTNNSSSEGTIENPTTSEDVKDNKRLRAIGVNTVGLQRMGLKENALFDSLA

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain