SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma04g13071

Feature Type:gene_model
Chromosome:Gm04
Start:12663693
stop:12664658
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G66980AT Annotation by Michelle Graham. TAIR10: suppressor of npr1-1 constitutive 4 | chr1:24997491-25001961 REVERSE LENGTH=1118 SoyBaseE_val: 3.00E-75ISS
GO:0000023GO-bp Annotation by Michelle Graham. GO Biological Process: maltose metabolic process SoyBaseN/AISS
GO:0006071GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol metabolic process SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0016556GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA modification SoyBaseN/AISS
GO:0019252GO-bp Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008081GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoric diester hydrolase activity SoyBaseN/AISS
GO:0008889GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerophosphodiester phosphodiesterase activity SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG1187 KOG Serine/threonine protein kinase JGI ISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PTHR24420:SF441Panther SUBFAMILY NOT NAMED JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_C6FF75UniRef Annotation by Michelle Graham. Most informative UniRef hit: Stress-induced receptor-like kinase n=1 Tax=Glycine max RepID=C6FF75_SOYBN SoyBaseE_val: 2.00E-145ISS
UniRef100_I1M9G6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M9G6_SOYBN SoyBaseE_val: 4.00E-150ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g13071 not represented in the dataset

Glyma04g13071 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g117300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma04g13071.1   sequence type=CDS   gene model=Glyma04g13071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTACAAATACATTGAAACCTATCTAGAACAAAATAACTTCATGCCTATTGGATACTCATACAAGGAAATTAAGAAGATGGTTGGAGGTTTCAAGGACAAATTAAGGGAAGGAGGTTATTATTCCGAGTTTAAGGGAAATTTGCATAATGGGCCTTGTGTAGCAATAAAAATGTTGAGTAAATCGAAAGGTAATGGACACGACTTTGGTAGTGAAGTTGCAACAATTGGAAGAATACATCATGAGAATGTAGTACAACTAATTGGATTTTGTGCTGAGGATTCCAAACGTGCTCTTTTTTATGAATTCATGCCTAATGGATCCCTTGACAAATTTATTTTTTCCAAAGATGGAAGCATACATTTAAGCTATGAGCAAATATATGATATATCAATTGGAGTAGCTCGTGGGATTGCTTGTCTCTATCATGGGTGTGAGTTGTGGATTTTGCATTTTGATATCAAGCCCCACAACATGCTACTCGATGAAAAATTCACCCCAAAGGCATCTGACTTTGGGTTGGCAAAGTTATATCCAATAGATAATAGCATTGTCACTATGACGTTAGCAATAGGGACAATTGGGTATATAGCTCTAGAATTTTATAAAAATAGTGGAGGAATATCCCATAAGGCTGATGTCTACAGCTTGGGGATGCTTTTGATGGAGATGATTTATGATCAACTTGGAAAAGAGAAAGATATAGAAATGGAAGATGTCATAGAGGATGAGAAGGAACTAGCAAAGAAGATGATCATAGTTGCACTTGGGTGTATACAGTTAAAACCCAATGATCACCCCTCTATGAACAAAGTAGTGGAGATGCTTGAAAGAGACATTCTTCTTTATATCCGCATGAATTTGCAGAGGATTCAAGAATCAACTCTAGCCAAACAATAA

>Glyma04g13071.1   sequence type=predicted peptide   gene model=Glyma04g13071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MYKYIETYLEQNNFMPIGYSYKEIKKMVGGFKDKLREGGYYSEFKGNLHNGPCVAIKMLSKSKGNGHDFGSEVATIGRIHHENVVQLIGFCAEDSKRALFYEFMPNGSLDKFIFSKDGSIHLSYEQIYDISIGVARGIACLYHGCELWILHFDIKPHNMLLDEKFTPKASDFGLAKLYPIDNSIVTMTLAIGTIGYIALEFYKNSGGISHKADVYSLGMLLMEMIYDQLGKEKDIEMEDVIEDEKELAKKMIIVALGCIQLKPNDHPSMNKVVEMLERDILLYIRMNLQRIQESTLAKQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo