Glyma04g12390 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g12390

Feature Type:	gene_model
Chromosome:	Gm04
Start:	11465875
stop:	11467555
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g12390

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G18040	AT	Annotation by Michelle Graham. TAIR10: MAP kinase 9 \| chr3:6175741-6178150 FORWARD LENGTH=422	SoyBase	E_val: 2.00E-37	ISS
GO:0006468	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein phosphorylation	SoyBase	N/A	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0004672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein kinase activity	SoyBase	N/A	ISS
GO:0004707	GO-mf	Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity	SoyBase	N/A	ISS
GO:0004713	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
PTHR24055	Panther	MITOGEN-ACTIVATED PROTEIN KINASE	JGI		ISS
PTHR24055:SF69	Panther		JGI		ISS
UniRef100_I1KQJ2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KQJ2_SOYBN	SoyBase	E_val: 4.00E-39	ISS
UniRef100_Q1SN03	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine protein kinase, active site n=1 Tax=Medicago truncatula RepID=Q1SN03_MEDTR	SoyBase	E_val: 6.00E-35	ISS

Expression Patterns of Glyma04g12390

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g12390 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g12390

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g12390

Limit To All Plant Sequences

>Glyma04g12390.1   sequence type=CDS   gene model=Glyma04g12390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TATGTTCCCAATCTCCTTCTTCTTCAACAACACGCATATCCATTCTTTCATTCTCTCTCTCATGGCTTCTTCTTCCATTTCTGCACCAACGCTCACCTTCCCGACACAGAAGCTTGTCGTTCCGTTCCCCGTGCAACGGACGCCCTCGCTCCTCCTGTTCCCATTGCAATCCCCCTGCCGCTGCCTTGCATCTGCCTCCTCCGACGACCGCAGTGTCGGCGCCAAACACAGCGGCTGGAAATCGATGAGCAAGAGCGCCTCCTCTCGATTTTCAAGTTACCTAATGATCCTAAAGACCGTCCATCAGCTAAAGAGACATTATCTAATCCTTACTTCACTGGCTTGGCGAACATGAACTGTGAACCATCCACTCAACCCATTTCAAAACTTGAGTTTGAATTTGAGAGACGGAAATTGACCAAAGATGATGTAAGAGAGTTGATTTATGGAGAGATTTTGGAGTATCATCCCCAAATGCTCCAGGAATATCTTCGTGGTGGAGATCAAACTAGCTTCATTATACTGCTACTGGAAAGGGTAGGACTTGGTAACATGCACACTACTTCTTTGTTGTTTGAAGCAAAGAGAAAGATAGAGAAGGGACAGGAG

Predicted protein sequences of Glyma04g12390

Limit To All Plant Sequences

>Glyma04g12390.1   sequence type=predicted peptide   gene model=Glyma04g12390   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
YVPNLLLLQQHAYPFFHSLSHGFFFHFCTNAHLPDTEACRSVPRATDALAPPVPIAIPLPLPCICLLRRPQCRRQTQRLEIDEQERLLSIFKLPNDPKDRPSAKETLSNPYFTGLANMNCEPSTQPISKLEFEFERRKLTKDDVRELIYGEILEYHPQMLQEYLRGGDQTSFIILLLERVGLGNMHTTSLLFEAKRKIEKGQE

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain