SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g11020

Feature Type:gene_model
Chromosome:Gm04
Start:9302118
stop:9302723
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g11020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G07320AT Annotation by Michelle Graham. TAIR10: ribosomal protein L4 | chr1:2249190-2250189 FORWARD LENGTH=280 SoyBaseE_val: 1.00E-52ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0000311GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid large ribosomal subunit SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009547GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid ribosome SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
PTHR10746Panther 50S RIBOSOMAL PROTEIN L4 JGI ISS
PTHR10746:SF2Panther gb def: l4p-like ribosomal protein, mitochodrial [schizosaccharomyces pombe] JGI ISS
PF00573PFAM Ribosomal protein L4/L1 family JGI ISS
UniRef100_B9SHY1UniRef Annotation by Michelle Graham. Most informative UniRef hit: 50S ribosomal protein L4, putative n=1 Tax=Ricinus communis RepID=B9SHY1_RICCO SoyBaseE_val: 5.00E-59ISS
UniRef100_I1JVE2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1JVE2_SOYBN SoyBaseE_val: 3.00E-128ISS

Expression Patterns of Glyma04g11020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g11020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g101800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g11020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g11020
>Glyma04g11020.2   sequence type=CDS   gene model=Glyma04g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCACTTTCCCTCTCTCTCTCCACACCAACAACACCAACCTCTCTTTCCTTCACATCATCCTCCATCTTCTTCTCTTCACACCAATTCCACACACACAATAATTCTTTCAAGTCCAACAACTTTCCCATTTTACCCTCCAAAAACCCCCTCTCCATTTCCTGCAAGGCCTCCCCTCCTCTTCCCGTCCTCAACTTCTCTGGCGAGAAGGTCGGCGAGTCCTTCCTCGACCTCCGCTTCACCCCTCCCGACACCGCTCGTGTCGTCGTCCACCATGCCGTCGTCACCGACCTCCAGAACAAGCGCCGCGGCACCGCCTCCACCCTCACCCGCGGCGAGGTCCGAGGCGGCGGCCGGAAGCCCTTCCTGCAGAAAAAAACCAGTCGCGCCTACCGGCCCTGCGGAGGCGTCATCTTCGGCCCGAAGCCCCACGACTGGTGCATCAAGATCAACTGCAAGGAGAAGCGCCTCGCCATCTCCACCGCTGTTGCCAACGTCGTCGCCAGTGCCGTTGTGGTGGAGGACTTTGCGGCGGAGTTCGCCGAGAAGCTAAAGACGAAGGAGTTCATCGCAGCGATGAAGCTGTTGCAAGAGAGAGAATAG
Predicted protein sequences of Glyma04g11020
>Glyma04g11020.2   sequence type=predicted peptide   gene model=Glyma04g11020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLSLSLSTPTTPTSLSFTSSSIFFSSHQFHTHNNSFKSNNFPILPSKNPLSISCKASPPLPVLNFSGEKVGESFLDLRFTPPDTARVVVHHAVVTDLQNKRRGTASTLTRGEVRGGGRKPFLQKKTSRAYRPCGGVIFGPKPHDWCIKINCKEKRLAISTAVANVVASAVVVEDFAAEFAEKLKTKEFIAAMKLLQERE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo