SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g10761

Feature Type:gene_model
Chromosome:Gm04
Start:9030583
stop:9031520
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g10761
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G21960AT Annotation by Michelle Graham. TAIR10: Peroxidase superfamily protein | chr4:11646613-11648312 REVERSE LENGTH=330 SoyBaseE_val: 2.00E-74ISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0004601GO-mf Annotation by Michelle Graham. GO Molecular Function: peroxidase activity SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
PF00141PFAM Peroxidase JGI ISS
UniRef100_Q9XFI6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Peroxidase n=1 Tax=Glycine max RepID=Q9XFI6_SOYBN SoyBaseE_val: 2.00E-81ISS
UniRef100_Q9XFI6UniRef Annotation by Michelle Graham. Best UniRef hit: Peroxidase n=1 Tax=Glycine max RepID=Q9XFI6_SOYBN SoyBaseE_val: 2.00E-81ISS

Expression Patterns of Glyma04g10761
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g10761 not represented in the dataset
Glyma04g10761 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g10761 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g099500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g10761
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g10761
>Glyma04g10761.1   sequence type=CDS   gene model=Glyma04g10761   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCTGAAGACATCATCACAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTACTTTCTCCTGGCTCAGAAACATCTTCCATGATTGTGTTGTTCAGAGTTGTGATGCTTCACTATTACTGGACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAAATAAAAACTTTGAGTCGAGAAATTTTAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGAGAATGCCCAAGAGTTGTTTCCTGTGCTGATATCCTCGTTCTCTCTACCAGAGATGGCATTAAAGATCAATCTATTTTTAGTGTGGGGATAAGTCCCCATATCCTTCTTAAAACTGGAAGAAAGGATGGTAGAAAGAGCAAAACTAATGTGGTTGAGCTGTTCCGCCCAAATCACAATAAGTCTATTTTTGTAGTTCTTGACAAGTTTGGTGCCATAGGAATTGACACCCCCAGCATCGTCGCATTACTTGGTACTATACACTCTCCCTTGACCCATCCATGTACATACATTTATGAAATGACAATACGGATAAAGCATACATAA
Predicted protein sequences of Glyma04g10761
>Glyma04g10761.1   sequence type=predicted peptide   gene model=Glyma04g10761   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AEDIITEQVKLLYKRHKNTTFSWLRNIFHDCVVQSCDASLLLDSTRRSLSEKETNKNFESRNFRYIETIKEALERECPRVVSCADILVLSTRDGIKDQSIFSVGISPHILLKTGRKDGRKSKTNVVELFRPNHNKSIFVVLDKFGAIGIDTPSIVALLGTIHSPLTHPCTYIYEMTIRIKHT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo