Glyma04g10230 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g10230

Feature Type:	gene_model
Chromosome:	Gm04
Start:	8449238
stop:	8453316
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g10230

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G09700	AT	Annotation by Michelle Graham. TAIR10: dsRNA-binding domain-like superfamily protein \| chr1:3137960-3140118 REVERSE LENGTH=419	SoyBase	E_val: 2.00E-87	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009735	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cytokinin stimulus	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0010267	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference	SoyBase	N/A	ISS
GO:0010305	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf vascular tissue pattern formation	SoyBase	N/A	ISS
GO:0010589	GO-bp	Annotation by Michelle Graham. GO Biological Process: leaf proximal/distal pattern formation	SoyBase	N/A	ISS
GO:0031054	GO-bp	Annotation by Michelle Graham. GO Biological Process: pre-miRNA processing	SoyBase	N/A	ISS
GO:0035196	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA	SoyBase	N/A	ISS
GO:0035279	GO-bp	Annotation by Michelle Graham. GO Biological Process: mRNA cleavage involved in gene silencing by miRNA	SoyBase	N/A	ISS
GO:0051607	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to virus	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0010445	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nuclear dicing body	SoyBase	N/A	ISS
GO:0003723	GO-mf	Annotation by Michelle Graham. GO Molecular Function: RNA binding	SoyBase	N/A	ISS
GO:0003725	GO-mf	Annotation by Michelle Graham. GO Molecular Function: double-stranded RNA binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0035198	GO-mf	Annotation by Michelle Graham. GO Molecular Function: miRNA binding	SoyBase	N/A	ISS
KOG3732	KOG	Staufen and related double-stranded-RNA-binding proteins	JGI		ISS
PTHR11207	Panther	RIBONUCLEASE III	JGI		ISS
PF00035	PFAM	Double-stranded RNA binding motif	JGI		ISS
UniRef100_G7J4K9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: DsRNA-binding protein n=1 Tax=Medicago truncatula RepID=G7J4K9_MEDTR	SoyBase	E_val: 2.00E-139	ISS
UniRef100_I1JV80	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JV80_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g10230

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g10230

Paralog	Evidence	Comments
Glyma06g10200	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g10230 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g095700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g10230

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g10230

Limit To All Plant Sequences

>Glyma04g10230.1   sequence type=CDS   gene model=Glyma04g10230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCCACTAACGAAGACTTCCAAAGTGTTTCAAATTGCTATGTGTTCAAGAGCCGATTGCAGGAGTATGCGCAGAAGGCGGGGCTGCCCACGCCTGTCTATGAAACTATTAAGGAAGGGCCTTCCCATGAACCTTCTTTCAGGTCAACAGTGATAGTGAACGACGTTCGCTATGATTCTTTGCCTGGATTTTTCAACCGCAAGGCGGCAGAGCAGTCGGCCGCAGAAGTTGCTTTGGTGGAGTTGGTCAAATCTAATGCAGTTAATCAGTCCATCACTCAACCTGTTCATGAAACAGGATTATGCAAGAATTTACTTCAGGAATATGCTCAGAAAATGAACTATGCAATGCCAATGTATCAGTGCAAGAAGGATGAAACACCAGGTCGAGCATCAGTATTTTCATGTACGGTTGACATTGGGGGGATTCTATATATTGGGGGAGCAGCAAAAACAAAGAAGGAAGCAGAGATAAAAGCTGCTAGAACTGCTTTATTAGCTATCCAGTCAAGTGCATCTCATGCTTCCGAAAACCAGGTTGGCCATCCACAGTTGACCGTCCTTCCATGCAGAAAAAGGGCAACAAGTTCTGTTGCCATAGCTGATGAGAATTCAAATCCCCCAAAGCCTAAGAAAGCGCGGTTTAAAAGGAAGTCTTCCAAGAGGAAACCCTCTAGAGATAAGATGGGCCAAATTCATACTGAAAACTTGGGCATTGGAGAAATTATCAATCATGAGGTAGAAACACATGCAAGTGTTAATGGTGAATCTGGCCTCCTTGAAAAGAAAACCGAAACATTCACTTCAGAAGCCACCAACAATTTTGAAAATGGAGTATCAGTTAACTATCAAGAGAAAGAAACATTGGCTGGGGAAAGTTCTTTTGCTGTGAATAGCCAGGAAGGGATTTTTGAAAATGGGAAGTCAACAGAATTATATTCCAAGGAGAACAATCTTGGGACTGTTGTTACAGAACTGTCTTCTGCGTCTAATGGAGGCATACCGGAACCAAGTGTGGAGGTGAACAAACAGCAATGCAATGGAGAAATGGTTTCTGACCATTGTGTTGTGGGGGATTAA

Predicted protein sequences of Glyma04g10230

Limit To All Plant Sequences

>Glyma04g10230.1   sequence type=predicted peptide   gene model=Glyma04g10230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPTNEDFQSVSNCYVFKSRLQEYAQKAGLPTPVYETIKEGPSHEPSFRSTVIVNDVRYDSLPGFFNRKAAEQSAAEVALVELVKSNAVNQSITQPVHETGLCKNLLQEYAQKMNYAMPMYQCKKDETPGRASVFSCTVDIGGILYIGGAAKTKKEAEIKAARTALLAIQSSASHASENQVGHPQLTVLPCRKRATSSVAIADENSNPPKPKKARFKRKSSKRKPSRDKMGQIHTENLGIGEIINHEVETHASVNGESGLLEKKTETFTSEATNNFENGVSVNYQEKETLAGESSFAVNSQEGIFENGKSTELYSKENNLGTVVTELSSASNGGIPEPSVEVNKQQCNGEMVSDHCVVGD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain