Glyma04g10210 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g10210

Feature Type:	gene_model
Chromosome:	Gm04
Start:	8440508
stop:	8441757
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g10210

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G24510	AT	Annotation by Michelle Graham. TAIR10: HXXXD-type acyl-transferase family protein \| chr4:12660929-12662537 FORWARD LENGTH=421	SoyBase	E_val: 3.00E-46	ISS
GO:0000038	GO-bp	Annotation by Michelle Graham. GO Biological Process: very long-chain fatty acid metabolic process	SoyBase	N/A	ISS
GO:0010025	GO-bp	Annotation by Michelle Graham. GO Biological Process: wax biosynthetic process	SoyBase	N/A	ISS
GO:0019344	GO-bp	Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process	SoyBase	N/A	ISS
GO:0042335	GO-bp	Annotation by Michelle Graham. GO Biological Process: cuticle development	SoyBase	N/A	ISS
GO:0042546	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis	SoyBase	N/A	ISS
GO:0042761	GO-bp	Annotation by Michelle Graham. GO Biological Process: very long-chain fatty acid biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0016740	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity	SoyBase	N/A	ISS
GO:0016747	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups	SoyBase	N/A	ISS
PF02458	PFAM	Transferase family	JGI		ISS
UniRef100_G7J4L2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Omega-hydroxypalmitate O-feruloyl transferase n=1 Tax=Medicago truncatula RepID=G7J4L2_MEDTR	SoyBase	E_val: 5.00E-113	ISS
UniRef100_I1JV79	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1JV79_SOYBN	SoyBase	E_val: 4.00E-180	ISS

Expression Patterns of Glyma04g10210

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g10210

Paralog	Evidence	Comments
Glyma06g10190	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g10210 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma04g10210

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g10210

Limit To All Plant Sequences

>Glyma04g10210.2   sequence type=CDS   gene model=Glyma04g10210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTAGGATTATCTGTGGGATTAAGCTGGGCTCACGTTCTTGGAGATGCCTTTTCTGCATTTAACTTCATCTCCAAGTGGAGTCAAATACTATCAGGTCAAGCCCCACCAAAATCTCTTCACACGCCAAATCTCCCTCAACCCAAAACCTCACCTAATTCCATTGTTGAGAACCCTCTAATTTCCATTAAAAAGACAAATATTGTAGGAGAGTATTGGCTCGCTACTAATGACAACGATGTGGCTACTTACTCTTTTCACATCACTTCCAAAAAACTTCACCATTTGGTAACTACCACATTTAATCAAACCAATGACAATACCAATGAGGCCAAGACCACCTATTTTGAAATTATTTCAGCGCTACTTTGGAAGTGCATAGCAAACATAAGGGGCCAACATTTTGGACCAAATGTTGTGACCATATGTACTAGTGAATCTAATCGTGCAGAAAATGAATTCCCCACCAATGGCTTCTTAGTGTTAAGCAAAGTTGAAGCAGATTTTTCAACTGGGAAATTTGAAATTTCCGAATTGGTAAAGCTGATTGCTGAGAACAAGATGGTTGAGAACCATGTAATGGAAGAATTGGTGGAGGGAGATGAAGGGAGAGAGGATTTTATAGCTTATGGGGTAAACTTGACGTTTGTGAATTTGGAAGAAGCTAATATTTATGATGGGGTGAAGCTAAATGAACAGAAACCAATTATGGCAAATTGTACATTTCGTGGGGTGAGTGATCAAGGGGAACATGATGGTAATGGAAGGATTGTTACAGTTTCTTTACCTCATGAAGAACTAGATCAGCTGAAAGATAAGCTAGGAGAAGAATGGGGCATACACTAA

Predicted protein sequences of Glyma04g10210

Limit To All Plant Sequences

>Glyma04g10210.2   sequence type=predicted peptide   gene model=Glyma04g10210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLGLSVGLSWAHVLGDAFSAFNFISKWSQILSGQAPPKSLHTPNLPQPKTSPNSIVENPLISIKKTNIVGEYWLATNDNDVATYSFHITSKKLHHLVTTTFNQTNDNTNEAKTTYFEIISALLWKCIANIRGQHFGPNVVTICTSESNRAENEFPTNGFLVLSKVEADFSTGKFEISELVKLIAENKMVENHVMEELVEGDEGREDFIAYGVNLTFVNLEEANIYDGVKLNEQKPIMANCTFRGVSDQGEHDGNGRIVTVSLPHEELDQLKDKLGEEWGIH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain