SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g10151

Feature Type:gene_model
Chromosome:Gm04
Start:8398096
stop:8398828
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g10151
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATCG00270AT Annotation by Michelle Graham. TAIR10: photosystem II reaction center protein D | chrC:32711-33772 FORWARD LENGTH=353 SoyBaseE_val: 4.00E-98ISS
GO:0006091GO-bp Annotation by Michelle Graham. GO Biological Process: generation of precursor metabolites and energy SoyBaseN/AISS
GO:0006354GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation SoyBaseN/AISS
GO:0009769GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light harvesting in photosystem II SoyBaseN/AISS
GO:0009772GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem II SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009523GO-cc Annotation by Michelle Graham. GO Cellular Compartment: photosystem II SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0030076GO-cc Annotation by Michelle Graham. GO Cellular Compartment: light-harvesting complex SoyBaseN/AISS
GO:0045156GO-mf Annotation by Michelle Graham. GO Molecular Function: electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity SoyBaseN/AISS
GO:0045157GO-mf Annotation by Michelle Graham. GO Molecular Function: electron transporter, transferring electrons within the noncyclic electron transport pathway of photosynthesis activity SoyBaseN/AISS
PF00124PFAM Photosynthetic reaction centre protein JGI ISS
UniRef100_A0AS46UniRef Annotation by Michelle Graham. Most informative UniRef hit: Photosystem II D2 protein (Fragment) n=1 Tax=Medeola virginiana RepID=A0AS46_MEDVI SoyBaseE_val: 5.00E-96ISS
UniRef100_A0AS46UniRef Annotation by Michelle Graham. Best UniRef hit: Photosystem II D2 protein (Fragment) n=1 Tax=Medeola virginiana RepID=A0AS46_MEDVI SoyBaseE_val: 5.00E-96ISS

Expression Patterns of Glyma04g10151
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g10151 not represented in the dataset
Glyma04g10151 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g10151 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g095000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g10151
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g10151
>Glyma04g10151.1   sequence type=CDS   gene model=Glyma04g10151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGGGAGTTGCTGGTGTATTGGGCACGACACTACTATGCGTTATTCATGGTGCCACCGTAGAAAATACTTTATTTGAAGATGGTGATGGCGCAAATACATTCCGTGCTTTTAACTCAACCCAAGCTGAAGAAACTTATTCAATGGTTACTGCTAATCGCTTTTGGTCCCAAATCTTTGGGGTTGCTTTTTCCAATAAACGTTGGTTACATGTCTTTATGTTATTTGTACCAGTAACTGGTTTATGGATGAGTGCTCTTGGGGTAGTCGATTTGGCCCTGAACCTACGTGCCTATGACTTCGTTTCTCAAGAAATCCGCGCAGCGGAAGATCCTGAATTTGAGACTTTCTACATCAATAATATTCTCTTAAACGAAGGTATTCGTGCATGGATGGCAGCTCAAGATCAGCCTCATGAAAACCTTATATTCCCTGAGGAGGTTCTATAG
Predicted protein sequences of Glyma04g10151
>Glyma04g10151.1   sequence type=predicted peptide   gene model=Glyma04g10151   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMGVAGVLGTTLLCVIHGATVENTLFEDGDGANTFRAFNSTQAEETYSMVTANRFWSQIFGVAFSNKRWLHVFMLFVPVTGLWMSALGVVDLALNLRAYDFVSQEIRAAEDPEFETFYINNILLNEGIRAWMAAQDQPHENLIFPEEVL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo