SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g09400

Feature Type:gene_model
Chromosome:Gm04
Start:7632108
stop:7633393
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g09400
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G09960AT Annotation by Michelle Graham. TAIR10: sucrose transporter 4 | chr1:3244258-3246718 FORWARD LENGTH=510 SoyBaseE_val: 2.00E-116ISS
GO:0015770GO-bp Annotation by Michelle Graham. GO Biological Process: sucrose transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005887GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to plasma membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005351GO-mf Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity SoyBaseN/AISS
GO:0008506GO-mf Annotation by Michelle Graham. GO Molecular Function: sucrose:hydrogen symporter activity SoyBaseN/AISS
GO:0008515GO-mf Annotation by Michelle Graham. GO Molecular Function: sucrose transmembrane transporter activity SoyBaseN/AISS
GO:0015144GO-mf Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity SoyBaseN/AISS
PTHR19432Panther SUCROSE TRANSPORT PROTEIN JGI ISS
PTHR19432:SF2Panther PROSTEIN PROTEIN JGI ISS
UniRef100_I1JV06UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JV06_SOYBN SoyBaseE_val: 0ISS
UniRef100_J7FDW2UniRef Annotation by Michelle Graham. Most informative UniRef hit: SUT4-2 n=1 Tax=Medicago truncatula RepID=J7FDW2_MEDTR SoyBaseE_val: 4.00E-152ISS

Expression Patterns of Glyma04g09400
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma04g09400 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g088900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g09400
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g09400
>Glyma04g09400.2   sequence type=CDS   gene model=Glyma04g09400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTAGGCAAGGATCACCGAAGGACACGTGTTGCAAATGCTTATTACTCCCTGTTTATGGCAATTGGTAATATTCTTGGATATACAACTGGATCATACAGTGGTTGGTACAAGGTCTTTGCTTTGGCACTTACCCCTGCATGCAATATTAGTTGTGCAAATCTCAAGTCTGCTTTATTTCTCGACATTATTTTCATTGCTGTCACCACATATATAAGCATTGTGGCAGCTAAAGAAGTGCCTCTAAGTTCAAGTGGAGCACTCCCTGTTGAAGAAGCAGCAGCAGGGGAATCAGGTACTGCAGGAGAAGCTTTCCTGTGGCAGCTATTTGGGACATTCAGATATTTTTCGACCCCTATATGGACAATACTGACTGTTAATGCTCTAAGATGGATTGGGTGGTTTCCATTTCTCCTATTTGATACTGATTGGATGGGCCGAGAGATTTATGGTGGTGAGCCAAATGAAGGCCCTAATCATGATACTGGAGTTAGAATGGGGGCACTTGGCTTACTGCTTAATTCAGTTGTTCTTGGAGTAACGTCAGTACTCTTGGAGAGGCTATGCAGGAAGCGGGGACCTGGGTTTCTGTGGGGAATTTCAAATATCCTAATGGCTGTCTGCTTTATTTCAATGCTTGTTGTAACCTATGTGGCAAATAACATTGGCTATGTAGGCAAAGATCTACCACCAACTGGCATTGTGATAGCTTCATTGATAATCTTTATCGTTCTTGGATTTCCACATGCAATCACTTACAGCTTTCCATATGCCTTGATTTCCACACACATTCAGTCATTGGGGCTTGGTCATTGTGGGCAGGATTGA
Predicted protein sequences of Glyma04g09400
>Glyma04g09400.2   sequence type=predicted peptide   gene model=Glyma04g09400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLGKDHRRTRVANAYYSLFMAIGNILGYTTGSYSGWYKVFALALTPACNISCANLKSALFLDIIFIAVTTYISIVAAKEVPLSSSGALPVEEAAAGESGTAGEAFLWQLFGTFRYFSTPIWTILTVNALRWIGWFPFLLFDTDWMGREIYGGEPNEGPNHDTGVRMGALGLLLNSVVLGVTSVLLERLCRKRGPGFLWGISNILMAVCFISMLVVTYVANNIGYVGKDLPPTGIVIASLIIFIVLGFPHAITYSFPYALISTHIQSLGLGHCGQD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo