SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08854

Feature Type:gene_model
Chromosome:Gm04
Start:6962180
stop:6968171
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g08854
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G63520AT Annotation by Michelle Graham. TAIR10: carotenoid cleavage dioxygenase 1 | chr3:23452940-23455896 FORWARD LENGTH=538 SoyBaseE_val: 9.00E-58ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0010304GO-bp Annotation by Michelle Graham. GO Biological Process: PSII associated light-harvesting complex II catabolic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0016118GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid catabolic process SoyBaseN/AISS
GO:0016121GO-bp Annotation by Michelle Graham. GO Biological Process: carotene catabolic process SoyBaseN/AISS
GO:0016124GO-bp Annotation by Michelle Graham. GO Biological Process: xanthophyll catabolic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0044242GO-bp Annotation by Michelle Graham. GO Biological Process: cellular lipid catabolic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0045549GO-mf Annotation by Michelle Graham. GO Molecular Function: 9-cis-epoxycarotenoid dioxygenase activity SoyBaseN/AISS
KOG1285 KOG Beta, beta-carotene 15,15'-dioxygenase and related enzymes JGI ISS
PTHR10543Panther CARTENOID OXYGENASE JGI ISS
PTHR10543:SF1Panther 9-CIS-EPOXYCAROTENOID DIOXYGENASE-RELATED JGI ISS
PF03055PFAM Retinal pigment epithelial membrane protein JGI ISS
UniRef100_B9RRX7UniRef Annotation by Michelle Graham. Most informative UniRef hit: 9-cis-epoxycarotenoid dioxygenase, putative n=1 Tax=Ricinus communis RepID=B9RRX7_RICCO SoyBaseE_val: 0ISS
UniRef100_UPI0002339C72UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339C72 related cluster n=1 Tax=unknown RepID=UPI0002339C72 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g08854
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g08854 not represented in the dataset
Glyma04g08854 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08854
ParalogEvidenceComments
Glyma06g08944 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08854 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g083500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g08854
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g08854
>Glyma04g08854.1   sequence type=CDS   gene model=Glyma04g08854   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAACGCATATGGCATTGGCAGCTTCATACATGACTCTTGCACCTAAATACTGCTGCGTTCAGAAACGACCCTTTATCATAACTTCAGGACTTTCCTCCGCCTTCAAGCCGATCTTAAGAGCGTTGCCTCAAATTCCACTGCAAATTGATGCTTCCAAAACCTTCACAGACATCAAATCGAAATTTCTTAACGCCGTTGTGGATTCAGCATTTGAGTTTGTCGACCAGCTTGTGCTTCCATCTCAGAGTAACTTTGCTCCGGTGGAGGAGTTAGGGGAAGCCGTGGCTATCACTAACATTGAAGGTGACATACCAGATCACTTTCCAGAGGGTGTCTTCATTAGAAATGGACCAAACCCACTCTTTGGAGGATTGAAATCATCCAAGTCTATCTTGGGGAGGACAAATAGCGTGTGGGTGGAAGGAGAAGGAATGCTTCATGCTTTGTATTTCAAAAGGGAAAGTGACGGGTGCTACACCATCGTCTACAACAACAGATATGTTGAAACTGAAACTTACAAGCTTGAGAAACAAAGTGCCAAGCCTTTGTTTCTCCCTGCCGTAAAAGGAGATTCATTGGCCGTTTTGTCTTCTATGCTTCTAAACGGGTTGAGATTTGGACAACTGAATAAAGATTATAGCAACACCAATGTGTTTGAGCATTCGGGCAAGTTCTACTCGGTTTCGGAGAATCACATGCCGCAAGAAATTGACATCTACACACTAAGTACATTGAAATACTGGGATGTCAATGGAGCATGCAATCGTCCTTTCGCCAGTCACCCCAAGAAAGTTCCAGGCACAGGAGAGCTGGTTATTTTTGGCGTAGATGCAACTAAACCTTATCTTGAAATTGGAATAGTTTCTGCTGATGGAAAGGAATTAGTTCATAAAGAAGACATAAAACTAGACAGATGCTCTTTATGCCATGATATAGGTATCACAAGCAGGTATATAGCGATATTGGATCTTCCACTGATTGTAGATTCAAACAGACTACTTAAAAGAGGCCCATTAATCAAGTACGAGAAGGAAAAATATGCCAGGATTGGGATAATGCCACTCTATGGTGATGAAAAATCAACCCAGTGGTTTGAGGTGGAACCTAATAGCACATTTCATATCATCAATTCCTTTGAGGATGGTCATGAGGTTGTGTTGTGGGGTTGTAGAGCATTAGATTCAATAATTCCAGGACCTGAAGATGGTCTAAATGAATCTACGATGTTCTCTCGGTGTTATGAATGGCGATTAAACATAAAAAGTGGGGAGGTTAAGGAAAAATATATCACTGGACCAGAACAGTTTATGGATTTTCCCGTAATTAATGCAAGTTTTACAGGAATTAAGAATAGATACGGATACACACAAGTGGTTGATCCCGCTGCAAGTTATGCTGCAGATATTCCTAAATATGGAGCTTTAGCGAAGCTATACTTTAGAGAACCATGTTCAGAATTTCCAAAGGGAGATACACAACAAAAGCCTATAAGGGTGGAATACCATAGGTTTGAAAGAAACGTATTTTGCACTGGATCTGCCTTTGTCCCTAAAGAAGGTGGTATTGAAGAAGATGATGGTTGGATAATCACTTTTGTTCACAATGAAGATACCGGCATATCTCAAGTTCATATAATTGAAACAAAGAAGTTTTCTGGTGAGGCAGTTGCCAAAATTACCATGCCTTTCAGAGTTCCATATGGATTTCACGGAGCTTTCATGCCACTCTCATTGTAG
Predicted protein sequences of Glyma04g08854
>Glyma04g08854.1   sequence type=predicted peptide   gene model=Glyma04g08854   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METHMALAASYMTLAPKYCCVQKRPFIITSGLSSAFKPILRALPQIPLQIDASKTFTDIKSKFLNAVVDSAFEFVDQLVLPSQSNFAPVEELGEAVAITNIEGDIPDHFPEGVFIRNGPNPLFGGLKSSKSILGRTNSVWVEGEGMLHALYFKRESDGCYTIVYNNRYVETETYKLEKQSAKPLFLPAVKGDSLAVLSSMLLNGLRFGQLNKDYSNTNVFEHSGKFYSVSENHMPQEIDIYTLSTLKYWDVNGACNRPFASHPKKVPGTGELVIFGVDATKPYLEIGIVSADGKELVHKEDIKLDRCSLCHDIGITSRYIAILDLPLIVDSNRLLKRGPLIKYEKEKYARIGIMPLYGDEKSTQWFEVEPNSTFHIINSFEDGHEVVLWGCRALDSIIPGPEDGLNESTMFSRCYEWRLNIKSGEVKEKYITGPEQFMDFPVINASFTGIKNRYGYTQVVDPAASYAADIPKYGALAKLYFREPCSEFPKGDTQQKPIRVEYHRFERNVFCTGSAFVPKEGGIEEDDGWIITFVHNEDTGISQVHIIETKKFSGEAVAKITMPFRVPYGFHGAFMPLSL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo