SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08831

Feature Type:gene_model
Chromosome:Gm04
Start:6943135
stop:6944833
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g08831
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G25810AT Annotation by Michelle Graham. TAIR10: tonoplast intrinsic protein 4;1 | chr2:11012658-11013906 FORWARD LENGTH=249 SoyBaseE_val: 3.00E-126ISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0009736GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinin mediated signaling pathway SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0042807GO-cc Annotation by Michelle Graham. GO Cellular Compartment: central vacuole SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0015250GO-mf Annotation by Michelle Graham. GO Molecular Function: water channel activity SoyBaseN/AISS
KOG0223 KOG Aquaporin (major intrinsic protein family) JGI ISS
PTHR19139Panther AQUAPORIN TRANSPORTER JGI ISS
PTHR19139:SF51Panther SUBFAMILY NOT NAMED JGI ISS
PF00230PFAM Major intrinsic protein JGI ISS
UniRef100_B9RS20UniRef Annotation by Michelle Graham. Most informative UniRef hit: Tonoplast intrinsic protein, putative n=1 Tax=Ricinus communis RepID=B9RS20_RICCO SoyBaseE_val: 2.00E-140ISS
UniRef100_UPI00018C6C49UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00018C6C49 related cluster n=1 Tax=unknown RepID=UPI00018C6C49 SoyBaseE_val: 8.00E-173ISS

Expression Patterns of Glyma04g08831
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g08831 not represented in the dataset
Glyma04g08831 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08831
ParalogEvidenceComments
Glyma06g08910 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08831 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g083200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g08831
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g08831
>Glyma04g08831.1   sequence type=CDS   gene model=Glyma04g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAAAATCGCACTTGGAAGCACCCGAGAGGCCACTCAGCCAGACTGCATTCAGGCCCTCATCGTTGAATTCATAGCCACCTTCCTCTTTGTCTTTGTTGGCGTTGGTTCTTCCATGGTCGTTGACAAGCTTGGTGGGGATGCACTAGTGGGATTGTTTGCTGTGGCCGTGGCACATGCACTTGTGGTGGCTGTAATGATCTCCGCCGCCCACATTTCCGGTGGCCACCTCAACCCCGCCGTCACCCTTGGCCTCCTCGCCGGTGGTCACATCACTATCTTTCGTTCCATGCTCTATTGGATTGATCAATTAGTAGCAGCCGCAACAGCTTCTTATCTCCTTTACTACCTCTCAGGAGGACAGGCAACTCCAGTTCATACGCTGGCCAGTGGAGTGGGGTATGGTCAAGGAGTAGTTTGGGAGATTGTGTTGACGTTTTCTTTGTTGTTCACTGTGTATGCGACCATGGTGGATCCCAAGAAGGGAGCACTTGCTGGGCTTGGGCCAACGCTGGTTGGGTTTGTGGTTGGGGCCAACATCCTCGCAGGTGGGGCTTACTCTGCTGCTTCTATGAACCCAGCAAGGTCTTTTGGGCCTGCCTTGGTCGCTGGAAACTGGACCGATCATTGGGTTTACTGGGTTGGGCCTCTCATTGGTGGTGGCCTTGCTGGTTACATCTATGAGACTTTCTTCATTGACCGATCTCATGTTCCACTTCCTCGTGATGAAGAAAACTAA
Predicted protein sequences of Glyma04g08831
>Glyma04g08831.1   sequence type=predicted peptide   gene model=Glyma04g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKIALGSTREATQPDCIQALIVEFIATFLFVFVGVGSSMVVDKLGGDALVGLFAVAVAHALVVAVMISAAHISGGHLNPAVTLGLLAGGHITIFRSMLYWIDQLVAAATASYLLYYLSGGQATPVHTLASGVGYGQGVVWEIVLTFSLLFTVYATMVDPKKGALAGLGPTLVGFVVGANILAGGAYSAASMNPARSFGPALVAGNWTDHWVYWVGPLIGGGLAGYIYETFFIDRSHVPLPRDEEN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo