SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08540

Feature Type:gene_model
Chromosome:Gm04
Start:6692425
stop:6696307
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g08540
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G32720AT Annotation by Michelle Graham. TAIR10: La protein 1 | chr4:15787313-15789498 FORWARD LENGTH=404 SoyBaseE_val: 6.00E-128ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0000478GO-bp Annotation by Michelle Graham. GO Biological Process: endonucleolytic cleavage involved in rRNA processing SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0009561GO-bp Annotation by Michelle Graham. GO Biological Process: megagametogenesis SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005654GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
KOG4213 KOG RNA-binding protein La JGI ISS
PTHR22792Panther LUPUS LA RIBONUCLEOPROTEIN JGI ISS
PTHR22792:SF4Panther RNA-BINDING PROTEIN-RELATED JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
PF05383PFAM La domain JGI ISS
PF08777PFAM RNA binding motif JGI ISS
UniRef100_B9RS49UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lupus la ribonucleoprotein, putative n=1 Tax=Ricinus communis RepID=B9RS49_RICCO SoyBaseE_val: 2.00E-166ISS
UniRef100_I1JUS4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JUS4_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g08540
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08540
ParalogEvidenceComments
Glyma06g08650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08540 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g080500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g08540
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g08540
>Glyma04g08540.1   sequence type=CDS   gene model=Glyma04g08540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGACGCAATCGTTAGACGAAGAAACAACTAAGAAAGTCATACGACAGGTCGAGTTTTATTTCGGCGACAGCAACCTTCTCACCGATGGTTTCATGAGGAAGAGTATCACTGAAAGCGAAGATGGCATGATTAGTTTGGCGCTGATTTGCTCGTTTAATCGAATGCGAAAACACCTTAATTTGGGTGATGTTAAGCCCGATGAAGTGGCCCAAGAAACCGTGAATACTGTTGCTCAAACTTTGAGAAATTCGGCTTCACTCAAGGTCTCCGAAGATGGGAAAAAAGTTGGCAGGAAAACTGAACTTCCAAAGCTAGAAGATGTTGAGCAGGTGGAGATAAGAACACTTGCTGTATCACCATTTGAATATGATCTGAAGCTTGAAGATGTGGAGAAATTTTTTGGTCAATATGCAAAGGTTAATAGTGTCCGGCTTCCCCATCATGTTGGAGACAAAAAGTTGTTCTGTGGCACTGCTCTTGTAGAATTCTCTTCAGAGGAAGAAGTAGAAAAGGTTATGAAGGAAAAAATGGTATATGCTGGGGCTGAGTTAGAATTAAAACCAAAGAAGGACTTTGATGCAGAGAGAGAAAAAGAATTAGAAGATTATAAAAAATCTCGTCCACCTGTGGGTTCAAATCACCAGAATAGCTCAAATGTAGAAGAAGACTACCCTAAAGGCTTAATTATTGCCTTCAAATTAAAGAGCATTTCAGAAGAAATTCCGTCTGAACAAAATGGTGTTGATCAACAAGCCAAGGACAATAGTGTTGTCTCCAAAACAGATGAAAACCCCCGCTCTGAAATTACTTCTGGGGAAAATGATCAAAAGGTAACAGAAAATGTTGGTGTTGATGAAGAAAAAAATGAGATGAAAGAAGCAAAGGAAACTGTAAATGAAGAGGACAATGAGATGAAAGAAGCAGAAGAAACTGAAAGTGAAGACAACACTGACATGAAAGAAGCAAAGGGAACTGAAAGTGAAGACAACAATGGGATGAAAGAAGGAAAGGTAACCAAAGATGAAGAAAAGAAACAACAAGCTGGTGAAAAATTTTCTGCCGCTGCTTACAAGGACAACATGGATGTTGTCTCACGTGAGGATTTGAAGAGTGTCTTTGAGAAATTTGGTACCGTGAAGTACATTGATTTCAAGATTGGAGCAGAGTCAGGATACATCCGCTTTGAAGAAACTGAAGCTGCTCAGAAAGCTCGTGCTGCTGCAGTTATTTCAGAAAAGGATGGCTTGGTTGTAAAGAATTATATTGCTATTCTAGATCCAGTGACTGGTGAGGCCGAAAAAGAATACTGGAGCCTGCTTCGTGGTAATCAAGGCAAACACCGAGAATTCAAGAATAAGCAAGGAAGGGGAGGATGGCATGGGAGAGGGGGCAAACATGCACGCTCTAGAGATAATGGGTCTAGAGATCGCCGAAATAAGGCTCAGAAAGTTGGTGGTGCATAA
Predicted protein sequences of Glyma04g08540
>Glyma04g08540.1   sequence type=predicted peptide   gene model=Glyma04g08540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATQSLDEETTKKVIRQVEFYFGDSNLLTDGFMRKSITESEDGMISLALICSFNRMRKHLNLGDVKPDEVAQETVNTVAQTLRNSASLKVSEDGKKVGRKTELPKLEDVEQVEIRTLAVSPFEYDLKLEDVEKFFGQYAKVNSVRLPHHVGDKKLFCGTALVEFSSEEEVEKVMKEKMVYAGAELELKPKKDFDAEREKELEDYKKSRPPVGSNHQNSSNVEEDYPKGLIIAFKLKSISEEIPSEQNGVDQQAKDNSVVSKTDENPRSEITSGENDQKVTENVGVDEEKNEMKEAKETVNEEDNEMKEAEETESEDNTDMKEAKGTESEDNNGMKEGKVTKDEEKKQQAGEKFSAAAYKDNMDVVSREDLKSVFEKFGTVKYIDFKIGAESGYIRFEETEAAQKARAAAVISEKDGLVVKNYIAILDPVTGEAEKEYWSLLRGNQGKHREFKNKQGRGGWHGRGGKHARSRDNGSRDRRNKAQKVGGA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo