SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08361

Feature Type:gene_model
Chromosome:Gm04
Start:6541682
stop:6545004
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g08361
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G32660AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr4:15756396-15759107 FORWARD LENGTH=400 SoyBaseE_val: 2.00E-173ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0045727GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of translation SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG0671 KOG LAMMER dual specificity kinases JGI ISS
PTHR24058Panther DUAL SPECIFICITY PROTEIN KINASE JGI ISS
PTHR24058:SF30Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G7J2X1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine protein kinase AFC3 n=1 Tax=Medicago truncatula RepID=G7J2X1_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0002339368UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339368 related cluster n=1 Tax=unknown RepID=UPI0002339368 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g08361
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g08361 not represented in the dataset
Glyma04g08361 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08361
ParalogEvidenceComments
Glyma06g08480 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08361 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g078900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g08361
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g08361
>Glyma04g08361.1   sequence type=CDS   gene model=Glyma04g08361   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATAGCTGTCGACAAATTTCACATGGAAAGAGAACGAACACGGAAACGCCCTCGTCTTGCATGGGACGTTGCCCCTCCCTCAGTGTCCGAGGCGCAACGGGCTCTGCCAGTGCCCGGTGACGAAGAATTCGAAAGAAAGCACGTTTCGCCTCCGAAAAGGGACGACGATCGAGAGGGCCATTATGTCTTCAATCTTGGCGAAAATCTCACTCCTAGATATAAAATCCTCAGCAAGATGGGTGAAGGCACATTTGGTCGGGTTTTGGAATGTTGGGACCGCCAAACCAGAGAATATGTGGCTATCAAGGTAGTTAGAAGCATACGGAAATACCGGGATGCAGCGATGCTTGAGATTGATGTGCTTCAACAACTAGCCAAGAATAATAGAGGAAGCTCCCGATGTGTGCAGATCAGAAATTGGTTTGATTACCGAAGCCACGTATGCATTGTCTTTGAGAGGCTTGGACCAAGCTTATTTGATTTTCTAAAGAGAAATAAATACTGCCCATTCCCTGTGGATCTTGTTCGGGAATTTGGACATATGCATGAATTACGCCTAATCCACACTGACCTGAAGCCAGAAAATATTCTTCTTGTTTCCTCTGAATATGTAAAGCTCCCTAGCTATAAGAGAGTTTCCTCAGATGAAACACAATTCAGGTGCTTGCCCAAGTCTAGTGCTATTAAGCTGATTGATTTTGGTAGTACCACATATGATAATCAGAATCATAGCTCCATTGTTTCTACAAGGCATTACAGAGCCCCTGAGATTATTCTAGGTCTAGGATGGTCATATCCATGTGATTTGTGGAGTGTTGGATGTATTCTCATTGAACTATGCTCGGGGGAAGCATTGTTTCAGACTCATGAAAACTTGGAGCACCTGGCAATGATGGAAAGAGTTTTGGGATCTATCCCAGAGCTCATGATTCGCAGGTCTAAGTCCTCCTTGACTGACTTGTTACATGGCTTATTAACATATGATCCGACCAAACGCCTTACAGCTTGCCAAGCCCTCGATCATATCTTCTTTAGGAATCCTACTTAA
Predicted protein sequences of Glyma04g08361
>Glyma04g08361.1   sequence type=predicted peptide   gene model=Glyma04g08361   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIAVDKFHMERERTRKRPRLAWDVAPPSVSEAQRALPVPGDEEFERKHVSPPKRDDDREGHYVFNLGENLTPRYKILSKMGEGTFGRVLECWDRQTREYVAIKVVRSIRKYRDAAMLEIDVLQQLAKNNRGSSRCVQIRNWFDYRSHVCIVFERLGPSLFDFLKRNKYCPFPVDLVREFGHMHELRLIHTDLKPENILLVSSEYVKLPSYKRVSSDETQFRCLPKSSAIKLIDFGSTTYDNQNHSSIVSTRHYRAPEIILGLGWSYPCDLWSVGCILIELCSGEALFQTHENLEHLAMMERVLGSIPELMIRRSKSSLTDLLHGLLTYDPTKRLTACQALDHIFFRNPT*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo