Glyma04g08250 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08250

Feature Type:	gene_model
Chromosome:	Gm04
Start:	6448422
stop:	6449423
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g08250

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G31320	AT	Annotation by Michelle Graham. TAIR10: SAUR-like auxin-responsive protein family \| chr4:15193993-15194562 REVERSE LENGTH=189	SoyBase	E_val: 9.00E-53	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005516	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calmodulin binding	SoyBase	N/A	ISS
PF02519	PFAM	Auxin responsive protein	JGI		ISS
UniRef100_G7J2U8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Auxin-induced protein 6B n=1 Tax=Medicago truncatula RepID=G7J2U8_MEDTR	SoyBase	E_val: 5.00E-99	ISS
UniRef100_I1JUP8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JUP8_SOYBN	SoyBase	E_val: 1.00E-123	ISS

Expression Patterns of Glyma04g08250

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08250

Paralog	Evidence	Comments
Glyma06g08340	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08250 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g078000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g08250

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g08250

Limit To All Plant Sequences

>Glyma04g08250.1   sequence type=CDS   gene model=Glyma04g08250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATAATCCTCCAAAGAAACCTAACAAGATCAGAGATATTGTGAGGCTTCAACAGATCCTTAAGAAATGGAGAAGGGTGGCCAACTCTTCAAAAACAAGCAGAAGTAACAACAACAGTAACAACACCACCAGCAGAAGCGTCAACTTTCTGAAAAGAACACTTTCAATATCTGAACGTGAAGGAGGAGGAACAAGCAACGTTGTTCCCAAGGGCTATGTAGCTGTTTGTGTTGGCGTGGACCTTAACAGGTTCGTTATACCAACCGAATATTTGGGTCACCAAGCCTTTCAAATGTTACTCAGAGAGACTGAGGAAGAATTTGGGTTTGAACAAACTGGGGTTTTGAGAATTCCTTGTGAAGTGTCGATGTTCGAGAGTATCTTGAAGATAGTGGAGAGAAAGGACAAGTTTTTCACTCAGAAATGCAGATTAAGCATTGAGAAGATGATGGGATACTGTTCCTCAAACAACCTTGCTTATTCTCATCAACCTCAAAGTCCAATGTGCAGATAG

Predicted protein sequences of Glyma04g08250

Limit To All Plant Sequences

>Glyma04g08250.1   sequence type=predicted peptide   gene model=Glyma04g08250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDNPPKKPNKIRDIVRLQQILKKWRRVANSSKTSRSNNNSNNTTSRSVNFLKRTLSISEREGGGTSNVVPKGYVAVCVGVDLNRFVIPTEYLGHQAFQMLLRETEEEFGFEQTGVLRIPCEVSMFESILKIVERKDKFFTQKCRLSIEKMMGYCSSNNLAYSHQPQSPMCR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain