SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g08181

Feature Type:gene_model
Chromosome:Gm04
Start:6410918
stop:6413911
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g08181
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G21080AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF3537 (InterPro:IPR021924); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF3537) (TAIR:AT3G20300.1); Has 141 Blast hits to 141 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 140; Viruses SoyBaseE_val: 8.00E-64ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF12056PFAM Protein of unknown function (DUF3537) JGI ISS
UniRef100_I1JUP1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JUP1_SOYBN SoyBaseE_val: 2.00E-113ISS
UniRef100_Q01J80UniRef Annotation by Michelle Graham. Most informative UniRef hit: OSIGBa0152K17.7 protein n=2 Tax=Oryza sativa RepID=Q01J80_ORYSA SoyBaseE_val: 2.00E-30ISS

Expression Patterns of Glyma04g08181
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g08181 not represented in the dataset
Glyma04g08181 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g08181
ParalogEvidenceComments
Glyma06g08240 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g08181 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g077200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g08181
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g08181
>Glyma04g08181.1   sequence type=CDS   gene model=Glyma04g08181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCCCTTCCTCCTCCAACCATCTTATGCGACACACGAACTGCGAAACCTTCGCACGAGCCTCAAATGGTGTGCTCTCGACCACTCTTCCCTCGTTGGAAAACTTATTTCCTACGTTGTCTTCATATTCCTCACCGTTGCTGTCCCTCTCTTCACTTCTCTCTTCGTTCATGTCCCTGCCTCTGCTTCTCAACTCTACCCTTTCAACTTCAAGAAGCTCCTTCAATTACCGCAATCAGCCCTCGCTATTATCGCCTTCTTCACTCTCTACCGTTTCTTCCCAAGGCATGGGCTTAGGTAGCTTCTGTTCCTACTTCCTAGATGTGTTACAAGATGACTCAACGTATGTTCGACGTGGGTACACGCGTGAGCTTCAGAAAGCGTTCAGATACTTAGCGTGCATGATATTACCTTCCTTTTTCGTAGAACTTGTTCACAAAACCATCTTCTTTTCTAGCATGGAAATTTCTGTCCCATGTGGGACCCCCCTGAACTGGGCTGTGTTTGTTTTAGTCTTGGTTTCCTGGGTTTACAGAACGGGGTTGTTCTTGTTGGCGTGTGTGCTTTTCAGGCTTAACTGCGAGCTTCAGATACTGAGGTTTGAAGGGCTTCACAAGCTCTTTGAAAGGTGTGGGTCTGATGCAAACATGACATTTAGAGAGCACGTGAGAATTAGGAGGCAATTGTGGATCACGAGTCATGGGTACAGGTTCTTTATAATTAGTTGTTTGGTGACAGTCACGGTTAGCCAGTTGGGTTCTCTCTTGATGGTTTTGGAATCCAAATCTGACACCACCTTCTTCAATTCCGGTGACCTTGTGATTTTTTTCGGCTGTGCAATTATGTGGATTCTTCTTTATGCCTTATGGGTGCGGCAAGAATCACACACAGAGCACAAGGGATAG
Predicted protein sequences of Glyma04g08181
>Glyma04g08181.1   sequence type=predicted peptide   gene model=Glyma04g08181   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFPSSSNHLMRHTNCETFARASNGVLSTTLPSLENLFPTLSSYSSPLLSLSSLLSSFMSLPLLLNSTLSTSRSSFNYRNQPSLLSPSSLSTVSSQGMGLGSFCSYFLDVLQDDSTYVRRGYTRELQKAFRYLACMILPSFFVELVHKTIFFSSMEISVPCGTPLNWAVFVLVLVSWVYRTGLFLLACVLFRLNCELQILRFEGLHKLFERCGSDANMTFREHVRIRRQLWITSHGYRFFIISCLVTVTVSQLGSLLMVLESKSDTTFFNSGDLVIFFGCAIMWILLYALWVRQESHTEHKG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo