SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g07841

Feature Type:gene_model
Chromosome:Gm04
Start:6106518
stop:6115269
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma04g07841
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G31120AT Annotation by Michelle Graham. TAIR10: SHK1 binding protein 1 | chr4:15132185-15136568 REVERSE LENGTH=642 SoyBaseE_val: 0ISS
GO:0006164GO-bp Annotation by Michelle Graham. GO Biological Process: purine nucleotide biosynthetic process SoyBaseN/AISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010074GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of meristem identity SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010220GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of vernalization response SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0008168GO-mf Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity SoyBaseN/AISS
GO:0008276GO-mf Annotation by Michelle Graham. GO Molecular Function: protein methyltransferase activity SoyBaseN/AISS
KOG0822 KOG Protein kinase inhibitor JGI ISS
PTHR10738Panther SHK1 KINASE-BINDING PROTEIN JGI ISS
PF05185PFAM PRMT5 arginine-N-methyltransferase JGI ISS
UniRef100_G7JCB5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein arginine N-methyltransferase n=1 Tax=Medicago truncatula RepID=G7JCB5_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI0001890C90UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001890C90 related cluster n=1 Tax=unknown RepID=UPI0001890C90 SoyBaseE_val: 0ISS

Expression Patterns of Glyma04g07841
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma04g07841 not represented in the dataset
Glyma04g07841 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g07841
ParalogEvidenceComments
Glyma06g07911 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g07841 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g074200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma04g07841
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma04g07841
>Glyma04g07841.1   sequence type=CDS   gene model=Glyma04g07841   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCTCTGGGAGAAAGAGCAGGGGATAAGAGCGAGTCTCGCTACTGCGGTGTAGAGACCGACTTCAACGATGACATGCCACACGTCCTCCATTTCAACCTTTATTCTGGAAGCTTCGATTTCGTTGTTGCTCCTCTGATGGATCATTCTTATCGGCCAAGTTTAGTGCAAAAGGATGCTTTGGGGTCTGGTGTTCTGCCATTTGCTGGGTCAGACTTGGTCTTGAGTCCATCCCAGTGGAGTAGTCATGTAGTGGGAAAAATTAGCTCATGGATAGATTTGGATTCAGAGGATGAAACCCTCAGGATAGATTCTGAAACCACTCTTAAACAAGAAATTGCTTGGGCTTCTCATCTCTCTTTACAGGCCTGCCTGCTTCCTGCCCCGAAGGGAACTTCTTGTGCTAATTATGCTAGATGTGTGAATCAGATCTTACAGGGTTCAAATAATATGCAGTTGTGGCTTAGGGTTCCATTGGTGAAGCCTGATGATGACTCTATGGATGCAAAGTCTGTTGCTTTGGTTGACTCTTGGGAAACTTGGAATTCATTTCGTCTGCTGTGTGAGCATCATAGTCAACTGTCAGTTGCACTTGATATTCTGAGTACTCTTCCTTCCCCAAATTCACTAGGACGCTGGTTTGGGGAGCCTGTTAGAGCAGCTATATTACATACTGATTGCTTTCTAACTAATTCTCATGGCTGTCCATGCCTCTCCAAGCGCCACCAGAGTTTAATTACTGGTTTTTTTAACCATTCTATTCAGATCATTGTATCTGGAAATTCAGTTCATCCAAAAGCAAGTGTGGATGCAAATGATAATTCTGGTACAAATTCACAAAGGCATCCCTTGCGGCCATATCTGGACTACATTGGATATCTTTACCAAAGAATGGATCCTCTTCCTGAGCAAGAACGTTTTGAGCTTGGTTACAGGGATTTTTTACAGTCACCCTTGCAACCTTTGATGGATAATTTAGAGGCTCAGACTTACGAGACTTTTGAGAGAGATGCAGTGAAATACATTCAGTACCAACGAGCAGTCAGTAAAGCATTGCTGGACAGGGTTCCTGATGAAGAGGCATCTGTTAAAACCATTGTATTGATGGTTGTGGGGGCAGGACGTGGGCCTCTTGTGCGGGCATCATTACAGGCTGCTGAAGAAACTGGGCGGAAGCTCAAAGTTTATGCTGTTGAAAAGAATCCAAATGCTGTTGTTACCCTACATGCATTAGTCAAGTTAGAAGGATGGGAGGATACTGTGACCATAGTCTCAAGTGACATGCGTCATTGGAGTGCCCCTGAAAAAGCTGACATATTGGTTAGTGAATTGCTAGGTTCTTTTGGCGACAATGAGCTGTCTCCTGAGTGCCTTGATGGAGCCCAGAGATTTCTAAAGCAAGATGGAATTTCAATACCATCTTCGTACACAAGTTTCCTCCAACCAGTGACAGCTTCAAAGTTATATAATGATGTTAAGGCACATAAAGATCTTGTACACTTTGAAACTGCTTATGTTGTCAAAATGCACAATGTAGCCAAACTTGCACCAACCCAACCTGTTTTTACATTTACTCATCCAAAGCACTCTGATAAAGAAATCAATCAGCGCTATAAAAAGTTGAATTTTATAATACCTAATGACACTGGGTCAGCAATGGTACACGGATTTGCTGGTTATTTTGATGCAACTCTTTACAAGGATGTGCATCTTGGAATTGAACCTTCAACTGCAACACCAAACATGTTCAGTTGGTTTGCAATATTTTTCCCATTAAGGACACCCATTTGTGTGGATCCCGGTTCTACACTTGAAGTACATTTTTGGCGTTGTTGTGGTTCTACGAAGGTTTGGTATGAGTGGTGTGTTGCTTCTCCCGCGTCGTCCCCAATGCACAACAGTAATGGACGTTCATACTGGGTTGGGCTTTAG
Predicted protein sequences of Glyma04g07841
>Glyma04g07841.1   sequence type=predicted peptide   gene model=Glyma04g07841   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPLGERAGDKSESRYCGVETDFNDDMPHVLHFNLYSGSFDFVVAPLMDHSYRPSLVQKDALGSGVLPFAGSDLVLSPSQWSSHVVGKISSWIDLDSEDETLRIDSETTLKQEIAWASHLSLQACLLPAPKGTSCANYARCVNQILQGSNNMQLWLRVPLVKPDDDSMDAKSVALVDSWETWNSFRLLCEHHSQLSVALDILSTLPSPNSLGRWFGEPVRAAILHTDCFLTNSHGCPCLSKRHQSLITGFFNHSIQIIVSGNSVHPKASVDANDNSGTNSQRHPLRPYLDYIGYLYQRMDPLPEQERFELGYRDFLQSPLQPLMDNLEAQTYETFERDAVKYIQYQRAVSKALLDRVPDEEASVKTIVLMVVGAGRGPLVRASLQAAEETGRKLKVYAVEKNPNAVVTLHALVKLEGWEDTVTIVSSDMRHWSAPEKADILVSELLGSFGDNELSPECLDGAQRFLKQDGISIPSSYTSFLQPVTASKLYNDVKAHKDLVHFETAYVVKMHNVAKLAPTQPVFTFTHPKHSDKEINQRYKKLNFIIPNDTGSAMVHGFAGYFDATLYKDVHLGIEPSTATPNMFSWFAIFFPLRTPICVDPGSTLEVHFWRCCGSTKVWYEWCVASPASSPMHNSNGRSYWVGL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo