Glyma04g07790 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma04g07790

Feature Type:	gene_model
Chromosome:	Gm04
Start:	6078176
stop:	6079192
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma04g07790

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G57560	AT	Annotation by Michelle Graham. TAIR10: N-acetyl-l-glutamate kinase \| chr3:21311164-21312207 REVERSE LENGTH=347	SoyBase	E_val: 1.00E-156	ISS
GO:0006526	GO-bp	Annotation by Michelle Graham. GO Biological Process: arginine biosynthetic process	SoyBase	N/A	ISS
GO:0006561	GO-bp	Annotation by Michelle Graham. GO Biological Process: proline biosynthetic process	SoyBase	N/A	ISS
GO:0008652	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process	SoyBase	N/A	ISS
GO:0042450	GO-bp	Annotation by Michelle Graham. GO Biological Process: arginine biosynthetic process via ornithine	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009534	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid	SoyBase	N/A	ISS
GO:0003991	GO-mf	Annotation by Michelle Graham. GO Molecular Function: acetylglutamate kinase activity	SoyBase	N/A	ISS
GO:0004349	GO-mf	Annotation by Michelle Graham. GO Molecular Function: glutamate 5-kinase activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0034618	GO-mf	Annotation by Michelle Graham. GO Molecular Function: arginine binding	SoyBase	N/A	ISS
KOG1154	KOG	Gamma-glutamyl kinase	JGI		ISS
PTHR24802	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24802:SF2	Panther		JGI		ISS
PF00696	PFAM	Amino acid kinase family	JGI		ISS
UniRef100_G7JCA9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Acetylglutamate kinase-like protein n=2 Tax=Medicago truncatula RepID=G7JCA9_MEDTR	SoyBase	E_val: 3.00E-173	ISS
UniRef100_I1JUK7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JUK7_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma04g07790

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma04g07790

Paralog	Evidence	Comments
Glyma06g07870	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma04g07790 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.04g073800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma04g07790

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma04g07790

Limit To All Plant Sequences

>Glyma04g07790.1   sequence type=CDS   gene model=Glyma04g07790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGGGGCAGCCAAAACCCTAACGAATCTTTGCCCCTCTTTTCCATTCACAACCAAACCCCAAAACCCACTCACCACACACCACTCTTTCCCTTCCACTCGCCTCCGCCACCGCGCCATTTCCGCGGTTGCCAACCCGGTCCAACCTCCACTCACCACCACCGAGGGTCAGTACCGAGTCGACGTGCTCTCGGAATCGCTCCCCTTCATCCAGAAATTCCGCGGCAAAACCATCGTCGTCAAGTACGGCGGCGCCGCCATGAAGTCCCCGGAGCTCCAGGCCTCCGTCATCAACGACCTCGTCCTCCTCTCCTGCGTCGGTCTACGCCCCGTTCTCGTCCACGGCGGTGGCCCCGAGATCAACTCCTGGCTCGGCCGCCTCAACATCCCCGCCGTCTTCCGCGACGGCCTCCGCGTCACGGACGCCGACACCATGGAGATTGTCTCCATGGTCCTCGTCGGAAAAGTCAACAAAACCCTAGTTTCTCTAATTAACAAGGCCGGCGCCACCGCTGTCGGCCTCTCCGGCATGGACGGCCGCCTCCTCACCGCCCGCCCCGCCCCCAAGGCTGCCGCCCTCGGCTTCGTCGGCGAGGTCGCACGCGTCGACCCCACTGTCCTCCGCTCCCTCATCGACACCAACCACATCCCCGTCGTCACCTCCATCGCCGCCGACGAGTCCGGACAGCCCTACAACATCAACGCCGACACCGTCGCCGGCGAATTGGCCGCGGCGCTCGGCGCTGAAAAGCTGATTCTGCTGACCGATGTAGCGGGAATATTGGAAGATCGTAACGACCCTGACAGCTTGGTTAAGAAGATTGACATAAAAGGAGTTAAGAAAATGATGGAAGATGAAAAAGTTGGCGGTGGAATGATACCTAAGGTTAATTGTTGCGTGAGATCGCTGGCGCAAGGGGTTACTACAGCGAGTATTATTGATGGTAGGGTTCCGCACTCTTTGTTGCTAGAGATTTTGACTGATGAAGGTGCTGGAACTATGATAACTGGATGA

Predicted protein sequences of Glyma04g07790

Limit To All Plant Sequences

>Glyma04g07790.1   sequence type=predicted peptide   gene model=Glyma04g07790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGAAKTLTNLCPSFPFTTKPQNPLTTHHSFPSTRLRHRAISAVANPVQPPLTTTEGQYRVDVLSESLPFIQKFRGKTIVVKYGGAAMKSPELQASVINDLVLLSCVGLRPVLVHGGGPEINSWLGRLNIPAVFRDGLRVTDADTMEIVSMVLVGKVNKTLVSLINKAGATAVGLSGMDGRLLTARPAPKAAALGFVGEVARVDPTVLRSLIDTNHIPVVTSIAADESGQPYNINADTVAGELAAALGAEKLILLTDVAGILEDRNDPDSLVKKIDIKGVKKMMEDEKVGGGMIPKVNCCVRSLAQGVTTASIIDGRVPHSLLLEILTDEGAGTMITG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain